Packs

Search filter terms
Filter by tag
Filter by user
Filter by licence
Filter by group
Results per page:
Sort by:
Showing 368 results. Use the filters on the left and the search box below to refine the results.
Creator

Pack Pack #3 - Search for molecules maximizing biological...


Created: 2017-06-30 16:33:44 | Last updated: 2017-12-19 10:22:03

This pack provides part of the supporting material for:Koch M, Duigou T, Carbonell P, Faulon JL. Molecular structures enumeration and virtual screening in the chemical space with RetroPath2.0. Journal of Cheminformatics, 9:64, 2017. https://doi.org/10.1186/s13321-017-0252-9The pack contains (i) the RetroPath2.0-Mods-iQSAR workflow for the search of molecules of interest, (ii) the QSAR-model-aminoglycosides workflow that build a QSAR model for predicting the antibacterial activity, and (iii) t...

3 items in this pack

Comments: 0 | Viewed: 64 times | Downloaded: 26 times

Tags:

Creator

Pack Pack #2 - Isomer enumeration (isomer transformation ...


Created: 2017-06-30 16:31:31 | Last updated: 2017-12-19 10:21:41

This pack provides part of the supporting material for:Koch M, Duigou T, Carbonell P, Faulon JL. Molecular structures enumeration and virtual screening in the chemical space with RetroPath2.0. Journal of Cheminformatics, 9:64, 2017. https://doi.org/10.1186/s13321-017-0252-9The pack contains (i) the RetroPath2.0-Mods-isomer-transformation worklfow, (ii) data for the enumeration of alkane isomers using the isomer transformation algorithm (see the main text for details, section 2.1 Isomer enumer...

5 items in this pack

Comments: 0 | Viewed: 73 times | Downloaded: 23 times

Tags:

Creator

Pack Pack #1 - Isomer enumeration (canonical augmentation...


Created: 2017-06-30 16:29:21 | Last updated: 2017-12-19 10:20:58

This pack provides part of the supporting material for:Koch M, Duigou T, Carbonell P, Faulon JL. Molecular structures enumeration and virtual screening in the chemical space with RetroPath2.0. Journal of Cheminformatics, 9:64, 2017. https://doi.org/10.1186/s13321-017-0252-9The pack contains the (i) RetroPath2.0-Mods-isomer-augmentation worklfow as well as (ii) the associated data for the enumeration of isomers using the canonical augmentation algorithm (see the main text for details, section ...

2 items in this pack

Comments: 0 | Viewed: 91 times | Downloaded: 26 times

Tags:

Creator

Pack Taverna 2.5 Core Starter Pack


Created: 2014-04-02 11:32:18 | Last updated: 2017-01-09 13:09:40

This is a Starter Pack for Taverna 2.5 Core edition - it contains a number of example workflows to showcase various features of Taverna 2.5 Core and help you get started using it.Workflows from this Starter pack can also be found in the myExperiment perspective of the Taverna Workbench.Tutorials for Taverna are available under the Taverna 2.x documentation on the Taverna Web site.Also check out the Taverna User Manual.

14 items in this pack

Comments: 0 | Viewed: 106 times | Downloaded: 33 times

Tags:

Creator
Project Biovel

Pack Matrix Population Models analyses pack


Created: 2013-08-14 10:37:55 | Last updated: 2014-07-25 10:56:14

This pack contains a workflow, a file and documentation (tutorial to run the workflow).The Matrix Population Models Workflow provides an environment  to perform several analyses on a stage-matrix with no density dependence:Eigen analysis.Age specific survival.Generation time (T).Net reproductive rate (Ro).Transient Dynamics.Resample a projection matrix (Confidence intervals of λ).Survival curveKeyfitz’s ΔCohen’s cumulative distance This workflow has bee...

3 items in this pack

Comments: 0 | Viewed: 115 times | Downloaded: 49 times

Tags:

Creator
Project Biovel

Pack Integral Projection Models pack


Created: 2013-08-13 12:51:30 | Last updated: 2015-06-12 13:48:44

This pack contains a workflow, a file and documentation (tutorial to run the workflow).The Integral Projection Model (IPM) Workflow provides an environment for create an integral projection model and to calculate its population growth, structure, sensitivities and elasticities analyses, age-specific metrics, etc.Create an IPM with no density dependence and perform several analyses on it.Analyses:Lambda (λ).Sensitivity analysis.Elasticity analysis.Parameters elasticity and sensitivity o...

3 items in this pack

Comments: 0 | Viewed: 146 times | Downloaded: 56 times

Tags:

Creator

Pack Concept profile analysis using Anni Web services


Created: 2013-02-06 19:11:26 | Last updated: 2014-07-15 08:17:33

Concept profile analysis is a knowledge discovery method that proved successful in generating hypotheses about molecular mechanisms explaining the results from genotype-phenotype studies. This technology has been implemented in the Anni standalone application (http://biosemantics.org/anni). This pack contains a number of workflows that can be used together to configure and run typical user pipelines from Anni through the Anni Web services (http://www.biocatalogue.org/services/3559).

11 items in this pack

Comments: 0 | Viewed: 134 times | Downloaded: 28 times

Tags:

Creator

Pack Recommender systems workflow templates 2012


Created: 2012-01-08 12:27:43 | Last updated: 2012-06-03 19:48:22

 The Recommender Extension can be downloaded from the Rapid-I Marketplace from: http://rapidupdate.de:8180/UpdateServer/faces/product_details.xhtml?productId=rmx_irbrecommender . More details can be found: http://elico.rapid-i.com/recommender-extension.html          

12 items in this pack

Comments: 0 | Viewed: 474 times | Downloaded: 145 times

Tags:

Creator

Pack Presentation - Socialising e-Science


Created: 2009-12-13 11:01:20 | Last updated: 2011-06-28 17:27:44

Title: Socialising e-Science Speaker: David De Roure Event: IEEE e-Science 2009 Event URL: http://www.escience2009.org/ Location: Oxford, UK Date: Tuesday December 8, 2009 Formats: .ppt and .pptx

3 items in this pack

Comments: 0 | Viewed: 83 times | Downloaded: 18 times

This Pack has no tags!

Creator

Pack Presentation - Lessons from myExperiment: Two insigh...


Created: 2009-12-13 10:58:37 | Last updated: 2009-12-13 11:06:19

Title: Lessons from myExperiment: Two insights into emerging e-Research practice Speaker: David De Roure Event: UK e-Science All Hands Meeting 2009 Event URL: http://www.allhands.org.uk/ Location: Oxford, UK Date: Monday December 7, 2009 Formats: .ppt and .pptx

2 items in this pack

Comments: 0 | Viewed: 78 times | Downloaded: 19 times

This Pack has no tags!

Creator

Pack Portugal Tutorial November 2009


Created: 2009-11-14 17:14:46 | Last updated: 2009-11-16 14:09:29

This is a pack containing all files for the collaborative team-building workflow exercise. 

8 items in this pack

Comments: 0 | Viewed: 77 times | Downloaded: 0 times

Tags:

Creator

Pack Presentation - Lessons from myExperiment: Research O...


Created: 2009-10-16 22:44:26 | Last updated: 2009-10-16 22:46:17

Title: Lessons from myExperiment: Research Objects for Data Intensive Research Speaker: David De Roure Event: Bio Microsoft e-Science 2009 Workshop Event URL: http://research.microsoft.com/en-us/events/escience2009/ Location: Pittsburgh, US Date: Friday, October 16, 2009 Formats: .ppt and .pptx    

2 items in this pack

Comments: 0 | Viewed: 52 times | Downloaded: 18 times

This Pack has no tags!

Creator

Pack Taverna 2 workflow example and associated provenance


Created: 2009-09-10 14:21:53 | Last updated: 2009-09-10 14:22:33

test workflow along with a raw provenance dump which can be imported into mySQL

2 items in this pack

Comments: 0 | Viewed: 57 times | Downloaded: 20 times

Tags:

Creator

Pack BioExtract Server Workflow Tutorial


Created: 2009-08-07 16:04:23 | Last updated: 2009-08-07 16:23:53

A tutorial to demonstrate how to create a workflow within the BioExtract Server at bioextract.org. Specifically, it shows how to perform a phylogenetic analysis on a set of proteins where the starting point is a query for specific nucleotide gene sequences.

1 item in this pack

Comments: 0 | Viewed: 117 times | Downloaded: 37 times

Tags:

Creator

Pack Presentation - myExperiment: Towards Research Objects


Created: 2009-07-14 09:55:39 | Last updated: 2011-08-17 13:04:48

Title: myExperiment: Towards Research Objects Speaker: David De Roure Event: DReSNet Workshop on Repositories and Biological Medical Applications Event URI: http://www.dresnet.net/ Location: Manchester, UK Date: Tuesday, July 14, 2009 Formats: .ppt  

1 item in this pack

Comments: 0 | Viewed: 57 times | Downloaded: 18 times

This Pack has no tags!

Creator

Pack Presentation - Where are we going and how are we goi...


Created: 2009-07-10 23:39:07 | Last updated: 2009-07-10 23:52:56

Title: Where are we going and how are we going to get there Speaker: David De Roure Event: JISC Projects start-up meeting Information Environment 2009-11 & Virtual Research Environment Event URI: http://www.jisc.ac.uk/whatwedo/programmes/inf11/inf11startup.aspx Location: Leicester, UK Date: Tuesday, July 7, 2009 Formats: .ppt  

2 items in this pack

Comments: 0 | Viewed: 45 times | Downloaded: 15 times

This Pack has no tags!

Creator

Pack Presentation - Social Networking and Workflows in Re...


Created: 2009-06-09 14:18:16 | Last updated: 2009-06-09 14:24:02

Title: Social Networking and Workflows in Research Speaker: David De Roure Event: Leaping Hurdles: Planning IT Provision for Researchers Event URI: http://www.nesc.ac.uk/esi/events/974/ Location: Edinburgh, UK Date: Tuesday, June 9, 2009 Formats: .ppt Notes: this event is being held in Edinburgh and then again in London  

1 item in this pack

Comments: 0 | Viewed: 60 times | Downloaded: 26 times

This Pack has no tags!

Creator

Pack Presentation - The Experiment that is myExperiment


Created: 2009-06-08 23:32:06 | Last updated: 2009-06-08 23:34:36

Title: The Experiment that is myExperiment Speaker: Carole Goble Event: Group 09 Event URI: http://www.group2009conference.com/ Location: Sanibel Island, Florida, USA Date: Monday, May 11, 2009 Formats: .ppt Abstract: myExperiment (http://www.myexperiment.org) is a community repository and virtual research environment that supports the sharing and reuse of scientific workflows and (increasingly) other kinds of experiment plans and methods. For researchers it provides a social infr...

1 item in this pack

Comments: 0 | Viewed: 57 times | Downloaded: 20 times

This Pack has no tags!

Creator

Pack AIDA remote runners


Created: 2009-05-15 16:08:03 | Last updated: 2009-05-15 16:11:20

Runners for AIDA demonstrations and testing

2 items in this pack

Comments: 0 | Viewed: 65 times | Downloaded: 35 times

Tags:

Creator

Pack Soils of western Wright Valley, Antarctica


Created: 2009-04-30 23:02:49 | Last updated: 2009-04-30 23:06:43

Soil profile descriptions and photographs of Soils of western Wright Valley, Antarctica. Supports Antarctic Science paper titled Soils of western Wright Valley, Antarctica to be published shortly.

1 item in this pack

Comments: 0 | Viewed: 50 times | Downloaded: 21 times

Tags:

Creator

Pack A test pack of stuff


Created: 2009-02-09 16:33:33 | Last updated: 2009-02-09 16:34:03

Testing what I can do with packs.

1 item in this pack

Comments: 0 | Viewed: 49 times | Downloaded: 29 times

Tags:

Creator

Pack Delete unwanted DNA from plasmids


Created: 2009-02-04 06:34:43 | Last updated: 2009-02-04 15:47:23

  psg5 (for HEG0 ERa, EcoR1): https://www.lablife.org/pglabs?f=c&cmd=viewvecseq&vectorid=3768 1021 GTAATACGACTCACTATAGGGCG AATT CGGATCCAGATCTTATTAAAGCA GAACTTGTTT Forward: 5'-ATACGACTCACTATAGGGCGCGGATCCAGATCTTAT-3' (20, 16) Reverse: 5'-TAATAAGATCTGGATCCGCGCCCTATAGTGAGTCG-3' (18, 17)   pGL2 (for p15 4xSBR1, kpn1, insert: 160 bp): https://www.lablife.org/pglabs?f=c&cmd=viewvecseq&vectorid=3345 1 cccgggaggtaccgagctcttacgcgtgct agctcgagat ctaagtaagc 5551 ccaaactc...

0 items in this pack

Comments: 0 | Viewed: 44 times | Downloaded: 8 times

This Pack has no tags!

Creator

Pack OMERO.editor example files


Created: 2008-10-07 12:48:42 | Last updated: 2008-10-07 12:54:32

OMERO.editor is a tool for metadata editing. see the website for more details.

3 items in this pack

Comments: 0 | Viewed: 52 times | Downloaded: 13 times

This Pack has no tags!

Creator

Pack Example workflows for annotated web services


Created: 2008-09-29 11:57:45 | Last updated: 2008-09-29 13:34:14

The pack contains a number of test workflows i built when i'm annotating web services. The workflows (one or two services) have all example parameters. Cool, now you can test some web services before add them to your workflows. Do you have any workflows you built to test a service? please add them to the pack. List of myGrid annotated web services:  http://www.mygrid.org.uk/feta/mygrid/descriptions/  

1 item in this pack

Comments: 0 | Viewed: 85 times | Downloaded: 29 times

Tags:

Creator

Pack Testing456


Created: 2008-07-12 08:42:06 | Last updated: 2008-07-12 08:43:01

subpack 1

1 item in this pack

Comments: 0 | Viewed: 35 times | Downloaded: 0 times

This Pack has no tags!

Results per page:
Sort by: