Packs

Search filter terms
Filter by tag
Filter by user
Filter by licence
Filter by group
Results per page:
Sort by:
Showing 368 results. Use the filters on the left and the search box below to refine the results.
Creator

Pack Portugal Tutorial November 2009


Created: 2009-11-14 17:14:46 | Last updated: 2009-11-16 14:09:29

This is a pack containing all files for the collaborative team-building workflow exercise. 

8 items in this pack

Comments: 0 | Viewed: 77 times | Downloaded: 0 times

Tags:

Creator

Pack Presentation - Lessons from myExperiment: Research O...


Created: 2009-10-16 22:44:26 | Last updated: 2009-10-16 22:46:17

Title: Lessons from myExperiment: Research Objects for Data Intensive Research Speaker: David De Roure Event: Bio Microsoft e-Science 2009 Workshop Event URL: http://research.microsoft.com/en-us/events/escience2009/ Location: Pittsburgh, US Date: Friday, October 16, 2009 Formats: .ppt and .pptx    

2 items in this pack

Comments: 0 | Viewed: 52 times | Downloaded: 18 times

This Pack has no tags!

Creator

Pack Taverna 2 workflow example and associated provenance


Created: 2009-09-10 14:21:53 | Last updated: 2009-09-10 14:22:33

test workflow along with a raw provenance dump which can be imported into mySQL

2 items in this pack

Comments: 0 | Viewed: 57 times | Downloaded: 20 times

Tags:

Creator

Pack BioExtract Server Workflow Tutorial


Created: 2009-08-07 16:04:23 | Last updated: 2009-08-07 16:23:53

A tutorial to demonstrate how to create a workflow within the BioExtract Server at bioextract.org. Specifically, it shows how to perform a phylogenetic analysis on a set of proteins where the starting point is a query for specific nucleotide gene sequences.

1 item in this pack

Comments: 0 | Viewed: 117 times | Downloaded: 37 times

Tags:

Creator

Pack Presentation - myExperiment: Towards Research Objects


Created: 2009-07-14 09:55:39 | Last updated: 2011-08-17 13:04:48

Title: myExperiment: Towards Research Objects Speaker: David De Roure Event: DReSNet Workshop on Repositories and Biological Medical Applications Event URI: http://www.dresnet.net/ Location: Manchester, UK Date: Tuesday, July 14, 2009 Formats: .ppt  

1 item in this pack

Comments: 0 | Viewed: 57 times | Downloaded: 18 times

This Pack has no tags!

Creator

Pack Presentation - Where are we going and how are we goi...


Created: 2009-07-10 23:39:07 | Last updated: 2009-07-10 23:52:56

Title: Where are we going and how are we going to get there Speaker: David De Roure Event: JISC Projects start-up meeting Information Environment 2009-11 & Virtual Research Environment Event URI: http://www.jisc.ac.uk/whatwedo/programmes/inf11/inf11startup.aspx Location: Leicester, UK Date: Tuesday, July 7, 2009 Formats: .ppt  

2 items in this pack

Comments: 0 | Viewed: 45 times | Downloaded: 15 times

This Pack has no tags!

Creator

Pack Presentation - Social Networking and Workflows in Re...


Created: 2009-06-09 14:18:16 | Last updated: 2009-06-09 14:24:02

Title: Social Networking and Workflows in Research Speaker: David De Roure Event: Leaping Hurdles: Planning IT Provision for Researchers Event URI: http://www.nesc.ac.uk/esi/events/974/ Location: Edinburgh, UK Date: Tuesday, June 9, 2009 Formats: .ppt Notes: this event is being held in Edinburgh and then again in London  

1 item in this pack

Comments: 0 | Viewed: 60 times | Downloaded: 26 times

This Pack has no tags!

Creator

Pack Presentation - The Experiment that is myExperiment


Created: 2009-06-08 23:32:06 | Last updated: 2009-06-08 23:34:36

Title: The Experiment that is myExperiment Speaker: Carole Goble Event: Group 09 Event URI: http://www.group2009conference.com/ Location: Sanibel Island, Florida, USA Date: Monday, May 11, 2009 Formats: .ppt Abstract: myExperiment (http://www.myexperiment.org) is a community repository and virtual research environment that supports the sharing and reuse of scientific workflows and (increasingly) other kinds of experiment plans and methods. For researchers it provides a social infr...

1 item in this pack

Comments: 0 | Viewed: 57 times | Downloaded: 20 times

This Pack has no tags!

Creator

Pack AIDA remote runners


Created: 2009-05-15 16:08:03 | Last updated: 2009-05-15 16:11:20

Runners for AIDA demonstrations and testing

2 items in this pack

Comments: 0 | Viewed: 65 times | Downloaded: 35 times

Tags:

Creator

Pack Soils of western Wright Valley, Antarctica


Created: 2009-04-30 23:02:49 | Last updated: 2009-04-30 23:06:43

Soil profile descriptions and photographs of Soils of western Wright Valley, Antarctica. Supports Antarctic Science paper titled Soils of western Wright Valley, Antarctica to be published shortly.

1 item in this pack

Comments: 0 | Viewed: 50 times | Downloaded: 21 times

Tags:

Creator

Pack A test pack of stuff


Created: 2009-02-09 16:33:33 | Last updated: 2009-02-09 16:34:03

Testing what I can do with packs.

1 item in this pack

Comments: 0 | Viewed: 49 times | Downloaded: 29 times

Tags:

Creator

Pack Delete unwanted DNA from plasmids


Created: 2009-02-04 06:34:43 | Last updated: 2009-02-04 15:47:23

  psg5 (for HEG0 ERa, EcoR1): https://www.lablife.org/pglabs?f=c&cmd=viewvecseq&vectorid=3768 1021 GTAATACGACTCACTATAGGGCG AATT CGGATCCAGATCTTATTAAAGCA GAACTTGTTT Forward: 5'-ATACGACTCACTATAGGGCGCGGATCCAGATCTTAT-3' (20, 16) Reverse: 5'-TAATAAGATCTGGATCCGCGCCCTATAGTGAGTCG-3' (18, 17)   pGL2 (for p15 4xSBR1, kpn1, insert: 160 bp): https://www.lablife.org/pglabs?f=c&cmd=viewvecseq&vectorid=3345 1 cccgggaggtaccgagctcttacgcgtgct agctcgagat ctaagtaagc 5551 ccaaactc...

0 items in this pack

Comments: 0 | Viewed: 44 times | Downloaded: 8 times

This Pack has no tags!

Creator

Pack OMERO.editor example files


Created: 2008-10-07 12:48:42 | Last updated: 2008-10-07 12:54:32

OMERO.editor is a tool for metadata editing. see the website for more details.

3 items in this pack

Comments: 0 | Viewed: 52 times | Downloaded: 13 times

This Pack has no tags!

Creator

Pack Example workflows for annotated web services


Created: 2008-09-29 11:57:45 | Last updated: 2008-09-29 13:34:14

The pack contains a number of test workflows i built when i'm annotating web services. The workflows (one or two services) have all example parameters. Cool, now you can test some web services before add them to your workflows. Do you have any workflows you built to test a service? please add them to the pack. List of myGrid annotated web services:  http://www.mygrid.org.uk/feta/mygrid/descriptions/  

1 item in this pack

Comments: 0 | Viewed: 85 times | Downloaded: 29 times

Tags:

Creator

Pack Testing456


Created: 2008-07-12 08:42:06 | Last updated: 2008-07-12 08:43:01

subpack 1

1 item in this pack

Comments: 0 | Viewed: 35 times | Downloaded: 0 times

This Pack has no tags!

Creator

Pack Testing123


Created: 2008-07-12 08:33:53 | Last updated: 2008-07-12 08:44:11

A pack that has packs

4 items in this pack

Comments: 0 | Viewed: 38 times | Downloaded: 12 times

This Pack has no tags!

Creator

Pack Isosteric transform library


Created: 2020-04-27 13:23:39 | Last updated: 2020-04-27 13:29:56

This Isostere pack contains files where isosteric transforms have been generated from a variety of sources and equivalent chemical descriptors.For example one can generate a measure of CDK molecular complexity (branching and ring order add complexity) and then find fragments , frequently occurring R-groups or small molecules that have same value. This naturally leads to well known isosteres, amongst others.

1 item in this pack

Comments: 0 | Viewed: 111 times | Downloaded: 9 times

Tags:

Creator

Pack Test


Created: 2019-10-03 17:23:53

Test

0 items in this pack

Comments: 0 | Viewed: 25 times | Downloaded: 5 times

Tags:

Creator

Pack IBISBA workflows


Created: 2018-01-28 19:40:56 | Last updated: 2018-01-28 19:43:39

Initial set of IBISBA WP7 workflows

2 items in this pack

Comments: 0 | Viewed: 13 times | Downloaded: 8 times

This Pack has no tags!

Creator

Pack Selenzyme


Created: 2017-08-18 08:23:47 | Last updated: 2017-08-23 11:12:00

Enzyme selection workflow for pathway design

2 items in this pack

Comments: 0 | Viewed: 49 times | Downloaded: 24 times

Tags:

Results per page:
Sort by: