Packs

Search filter terms
Filter by tag
Filter by user
Filter by licence
Filter by group
Results per page:
Sort by:
Showing 368 results. Use the filters on the left and the search box below to refine the results.
Creator

Pack Pack #3 - Search for molecules maximizing biological...


Created: 2017-06-30 16:33:44 | Last updated: 2017-12-19 10:22:03

This pack provides part of the supporting material for:Koch M, Duigou T, Carbonell P, Faulon JL. Molecular structures enumeration and virtual screening in the chemical space with RetroPath2.0. Journal of Cheminformatics, 9:64, 2017. https://doi.org/10.1186/s13321-017-0252-9The pack contains (i) the RetroPath2.0-Mods-iQSAR workflow for the search of molecules of interest, (ii) the QSAR-model-aminoglycosides workflow that build a QSAR model for predicting the antibacterial activity, and (iii) t...

3 items in this pack

Comments: 0 | Viewed: 64 times | Downloaded: 26 times

Tags:

Creator

Pack Pack #2 - Isomer enumeration (isomer transformation ...


Created: 2017-06-30 16:31:31 | Last updated: 2017-12-19 10:21:41

This pack provides part of the supporting material for:Koch M, Duigou T, Carbonell P, Faulon JL. Molecular structures enumeration and virtual screening in the chemical space with RetroPath2.0. Journal of Cheminformatics, 9:64, 2017. https://doi.org/10.1186/s13321-017-0252-9The pack contains (i) the RetroPath2.0-Mods-isomer-transformation worklfow, (ii) data for the enumeration of alkane isomers using the isomer transformation algorithm (see the main text for details, section 2.1 Isomer enumer...

5 items in this pack

Comments: 0 | Viewed: 73 times | Downloaded: 23 times

Tags:

Creator

Pack Pack #1 - Isomer enumeration (canonical augmentation...


Created: 2017-06-30 16:29:21 | Last updated: 2017-12-19 10:20:58

This pack provides part of the supporting material for:Koch M, Duigou T, Carbonell P, Faulon JL. Molecular structures enumeration and virtual screening in the chemical space with RetroPath2.0. Journal of Cheminformatics, 9:64, 2017. https://doi.org/10.1186/s13321-017-0252-9The pack contains the (i) RetroPath2.0-Mods-isomer-augmentation worklfow as well as (ii) the associated data for the enumeration of isomers using the canonical augmentation algorithm (see the main text for details, section ...

2 items in this pack

Comments: 0 | Viewed: 91 times | Downloaded: 26 times

Tags:

Creator

Pack Taverna 2.5 Core Starter Pack


Created: 2014-04-02 11:32:18 | Last updated: 2017-01-09 13:09:40

This is a Starter Pack for Taverna 2.5 Core edition - it contains a number of example workflows to showcase various features of Taverna 2.5 Core and help you get started using it.Workflows from this Starter pack can also be found in the myExperiment perspective of the Taverna Workbench.Tutorials for Taverna are available under the Taverna 2.x documentation on the Taverna Web site.Also check out the Taverna User Manual.

14 items in this pack

Comments: 0 | Viewed: 106 times | Downloaded: 33 times

Tags:

Creator
Project Biovel

Pack Matrix Population Models analyses pack


Created: 2013-08-14 10:37:55 | Last updated: 2014-07-25 10:56:14

This pack contains a workflow, a file and documentation (tutorial to run the workflow).The Matrix Population Models Workflow provides an environment  to perform several analyses on a stage-matrix with no density dependence:Eigen analysis.Age specific survival.Generation time (T).Net reproductive rate (Ro).Transient Dynamics.Resample a projection matrix (Confidence intervals of λ).Survival curveKeyfitz’s ΔCohen’s cumulative distance This workflow has bee...

3 items in this pack

Comments: 0 | Viewed: 115 times | Downloaded: 49 times

Tags:

Creator
Project Biovel

Pack Integral Projection Models pack


Created: 2013-08-13 12:51:30 | Last updated: 2015-06-12 13:48:44

This pack contains a workflow, a file and documentation (tutorial to run the workflow).The Integral Projection Model (IPM) Workflow provides an environment for create an integral projection model and to calculate its population growth, structure, sensitivities and elasticities analyses, age-specific metrics, etc.Create an IPM with no density dependence and perform several analyses on it.Analyses:Lambda (λ).Sensitivity analysis.Elasticity analysis.Parameters elasticity and sensitivity o...

3 items in this pack

Comments: 0 | Viewed: 146 times | Downloaded: 56 times

Tags:

Creator

Pack Concept profile analysis using Anni Web services


Created: 2013-02-06 19:11:26 | Last updated: 2014-07-15 08:17:33

Concept profile analysis is a knowledge discovery method that proved successful in generating hypotheses about molecular mechanisms explaining the results from genotype-phenotype studies. This technology has been implemented in the Anni standalone application (http://biosemantics.org/anni). This pack contains a number of workflows that can be used together to configure and run typical user pipelines from Anni through the Anni Web services (http://www.biocatalogue.org/services/3559).

11 items in this pack

Comments: 0 | Viewed: 134 times | Downloaded: 28 times

Tags:

Creator

Pack Recommender systems workflow templates 2012


Created: 2012-01-08 12:27:43 | Last updated: 2012-06-03 19:48:22

 The Recommender Extension can be downloaded from the Rapid-I Marketplace from: http://rapidupdate.de:8180/UpdateServer/faces/product_details.xhtml?productId=rmx_irbrecommender . More details can be found: http://elico.rapid-i.com/recommender-extension.html          

12 items in this pack

Comments: 0 | Viewed: 474 times | Downloaded: 145 times

Tags:

Creator

Pack Presentation - Socialising e-Science


Created: 2009-12-13 11:01:20 | Last updated: 2011-06-28 17:27:44

Title: Socialising e-Science Speaker: David De Roure Event: IEEE e-Science 2009 Event URL: http://www.escience2009.org/ Location: Oxford, UK Date: Tuesday December 8, 2009 Formats: .ppt and .pptx

3 items in this pack

Comments: 0 | Viewed: 83 times | Downloaded: 18 times

This Pack has no tags!

Creator

Pack Presentation - Lessons from myExperiment: Two insigh...


Created: 2009-12-13 10:58:37 | Last updated: 2009-12-13 11:06:19

Title: Lessons from myExperiment: Two insights into emerging e-Research practice Speaker: David De Roure Event: UK e-Science All Hands Meeting 2009 Event URL: http://www.allhands.org.uk/ Location: Oxford, UK Date: Monday December 7, 2009 Formats: .ppt and .pptx

2 items in this pack

Comments: 0 | Viewed: 78 times | Downloaded: 19 times

This Pack has no tags!

Creator

Pack Portugal Tutorial November 2009


Created: 2009-11-14 17:14:46 | Last updated: 2009-11-16 14:09:29

This is a pack containing all files for the collaborative team-building workflow exercise. 

8 items in this pack

Comments: 0 | Viewed: 77 times | Downloaded: 0 times

Tags:

Creator

Pack Presentation - Lessons from myExperiment: Research O...


Created: 2009-10-16 22:44:26 | Last updated: 2009-10-16 22:46:17

Title: Lessons from myExperiment: Research Objects for Data Intensive Research Speaker: David De Roure Event: Bio Microsoft e-Science 2009 Workshop Event URL: http://research.microsoft.com/en-us/events/escience2009/ Location: Pittsburgh, US Date: Friday, October 16, 2009 Formats: .ppt and .pptx    

2 items in this pack

Comments: 0 | Viewed: 52 times | Downloaded: 18 times

This Pack has no tags!

Creator

Pack Taverna 2 workflow example and associated provenance


Created: 2009-09-10 14:21:53 | Last updated: 2009-09-10 14:22:33

test workflow along with a raw provenance dump which can be imported into mySQL

2 items in this pack

Comments: 0 | Viewed: 57 times | Downloaded: 20 times

Tags:

Creator

Pack BioExtract Server Workflow Tutorial


Created: 2009-08-07 16:04:23 | Last updated: 2009-08-07 16:23:53

A tutorial to demonstrate how to create a workflow within the BioExtract Server at bioextract.org. Specifically, it shows how to perform a phylogenetic analysis on a set of proteins where the starting point is a query for specific nucleotide gene sequences.

1 item in this pack

Comments: 0 | Viewed: 117 times | Downloaded: 37 times

Tags:

Creator

Pack Presentation - myExperiment: Towards Research Objects


Created: 2009-07-14 09:55:39 | Last updated: 2011-08-17 13:04:48

Title: myExperiment: Towards Research Objects Speaker: David De Roure Event: DReSNet Workshop on Repositories and Biological Medical Applications Event URI: http://www.dresnet.net/ Location: Manchester, UK Date: Tuesday, July 14, 2009 Formats: .ppt  

1 item in this pack

Comments: 0 | Viewed: 57 times | Downloaded: 18 times

This Pack has no tags!

Creator

Pack Presentation - Where are we going and how are we goi...


Created: 2009-07-10 23:39:07 | Last updated: 2009-07-10 23:52:56

Title: Where are we going and how are we going to get there Speaker: David De Roure Event: JISC Projects start-up meeting Information Environment 2009-11 & Virtual Research Environment Event URI: http://www.jisc.ac.uk/whatwedo/programmes/inf11/inf11startup.aspx Location: Leicester, UK Date: Tuesday, July 7, 2009 Formats: .ppt  

2 items in this pack

Comments: 0 | Viewed: 45 times | Downloaded: 15 times

This Pack has no tags!

Creator

Pack Presentation - Social Networking and Workflows in Re...


Created: 2009-06-09 14:18:16 | Last updated: 2009-06-09 14:24:02

Title: Social Networking and Workflows in Research Speaker: David De Roure Event: Leaping Hurdles: Planning IT Provision for Researchers Event URI: http://www.nesc.ac.uk/esi/events/974/ Location: Edinburgh, UK Date: Tuesday, June 9, 2009 Formats: .ppt Notes: this event is being held in Edinburgh and then again in London  

1 item in this pack

Comments: 0 | Viewed: 60 times | Downloaded: 26 times

This Pack has no tags!

Creator

Pack Presentation - The Experiment that is myExperiment


Created: 2009-06-08 23:32:06 | Last updated: 2009-06-08 23:34:36

Title: The Experiment that is myExperiment Speaker: Carole Goble Event: Group 09 Event URI: http://www.group2009conference.com/ Location: Sanibel Island, Florida, USA Date: Monday, May 11, 2009 Formats: .ppt Abstract: myExperiment (http://www.myexperiment.org) is a community repository and virtual research environment that supports the sharing and reuse of scientific workflows and (increasingly) other kinds of experiment plans and methods. For researchers it provides a social infr...

1 item in this pack

Comments: 0 | Viewed: 57 times | Downloaded: 20 times

This Pack has no tags!

Creator

Pack AIDA remote runners


Created: 2009-05-15 16:08:03 | Last updated: 2009-05-15 16:11:20

Runners for AIDA demonstrations and testing

2 items in this pack

Comments: 0 | Viewed: 65 times | Downloaded: 35 times

Tags:

Creator

Pack Soils of western Wright Valley, Antarctica


Created: 2009-04-30 23:02:49 | Last updated: 2009-04-30 23:06:43

Soil profile descriptions and photographs of Soils of western Wright Valley, Antarctica. Supports Antarctic Science paper titled Soils of western Wright Valley, Antarctica to be published shortly.

1 item in this pack

Comments: 0 | Viewed: 50 times | Downloaded: 21 times

Tags:

Creator

Pack A test pack of stuff


Created: 2009-02-09 16:33:33 | Last updated: 2009-02-09 16:34:03

Testing what I can do with packs.

1 item in this pack

Comments: 0 | Viewed: 49 times | Downloaded: 29 times

Tags:

Creator

Pack Delete unwanted DNA from plasmids


Created: 2009-02-04 06:34:43 | Last updated: 2009-02-04 15:47:23

  psg5 (for HEG0 ERa, EcoR1): https://www.lablife.org/pglabs?f=c&cmd=viewvecseq&vectorid=3768 1021 GTAATACGACTCACTATAGGGCG AATT CGGATCCAGATCTTATTAAAGCA GAACTTGTTT Forward: 5'-ATACGACTCACTATAGGGCGCGGATCCAGATCTTAT-3' (20, 16) Reverse: 5'-TAATAAGATCTGGATCCGCGCCCTATAGTGAGTCG-3' (18, 17)   pGL2 (for p15 4xSBR1, kpn1, insert: 160 bp): https://www.lablife.org/pglabs?f=c&cmd=viewvecseq&vectorid=3345 1 cccgggaggtaccgagctcttacgcgtgct agctcgagat ctaagtaagc 5551 ccaaactc...

0 items in this pack

Comments: 0 | Viewed: 44 times | Downloaded: 8 times

This Pack has no tags!

Creator

Pack OMERO.editor example files


Created: 2008-10-07 12:48:42 | Last updated: 2008-10-07 12:54:32

OMERO.editor is a tool for metadata editing. see the website for more details.

3 items in this pack

Comments: 0 | Viewed: 52 times | Downloaded: 13 times

This Pack has no tags!

Creator

Pack Example workflows for annotated web services


Created: 2008-09-29 11:57:45 | Last updated: 2008-09-29 13:34:14

The pack contains a number of test workflows i built when i'm annotating web services. The workflows (one or two services) have all example parameters. Cool, now you can test some web services before add them to your workflows. Do you have any workflows you built to test a service? please add them to the pack. List of myGrid annotated web services:  http://www.mygrid.org.uk/feta/mygrid/descriptions/  

1 item in this pack

Comments: 0 | Viewed: 85 times | Downloaded: 29 times

Tags:

Creator

Pack Testing456


Created: 2008-07-12 08:42:06 | Last updated: 2008-07-12 08:43:01

subpack 1

1 item in this pack

Comments: 0 | Viewed: 35 times | Downloaded: 0 times

This Pack has no tags!

Creator

Pack Testing123


Created: 2008-07-12 08:33:53 | Last updated: 2008-07-12 08:44:11

A pack that has packs

4 items in this pack

Comments: 0 | Viewed: 38 times | Downloaded: 12 times

This Pack has no tags!

Creator

Pack Isosteric transform library


Created: 2020-04-27 13:23:39 | Last updated: 2020-04-27 13:29:56

This Isostere pack contains files where isosteric transforms have been generated from a variety of sources and equivalent chemical descriptors.For example one can generate a measure of CDK molecular complexity (branching and ring order add complexity) and then find fragments , frequently occurring R-groups or small molecules that have same value. This naturally leads to well known isosteres, amongst others.

1 item in this pack

Comments: 0 | Viewed: 111 times | Downloaded: 9 times

Tags:

Creator

Pack Test


Created: 2019-10-03 17:23:53

Test

0 items in this pack

Comments: 0 | Viewed: 25 times | Downloaded: 5 times

Tags:

Creator

Pack IBISBA workflows


Created: 2018-01-28 19:40:56 | Last updated: 2018-01-28 19:43:39

Initial set of IBISBA WP7 workflows

2 items in this pack

Comments: 0 | Viewed: 13 times | Downloaded: 8 times

This Pack has no tags!

Creator

Pack Selenzyme


Created: 2017-08-18 08:23:47 | Last updated: 2017-08-23 11:12:00

Enzyme selection workflow for pathway design

2 items in this pack

Comments: 0 | Viewed: 49 times | Downloaded: 24 times

Tags:

Creator

Pack Workflows for scaffold trend analyses


Created: 2017-06-22 13:01:47 | Last updated: 2018-06-14 09:37:37

These two KNIME workflows were used to process the raw data (retrieved via sql query from ChEMBL) in order to retrieve the final data for scaffold trend analyses as described in the paper: "The rise and fall of a scaffold: A trend analysis of scaffolds in the medicinal chemistry literature" by B. Zdrazil and R. Guha, Journal of Medicinal Chemistry, 2018, 61 (11), pp 4688-4703.

2 items in this pack

Comments: 0 | Viewed: 42 times | Downloaded: 24 times

Tags:

Pack Open research data reutilization tool


Created: 2017-01-20 16:44:15 | Last updated: 2017-03-15 07:30:53

Workflows created in order to perform a machine learning project using open research data from the Harvard Dataverse. This work is the result of my master's thesis and you are very welcome to collaborate!

4 items in this pack

Comments: 0 | Viewed: 35 times | Downloaded: 4 times

This Pack has no tags!

Creator

Pack Supplementary information for paper submission @ F10...


Created: 2016-10-25 14:57:58 | Last updated: 2016-10-25 15:06:18

This pack contains the files that belong to supplementary information of the paper submission at F1000Research. Note: This is a temporary link for the review proccess of the thesis "Knowledge discovery methods in Huntington's Disease" by Eleni Mina, till the data are published online at the F1000Research

5 items in this pack

Comments: 0 | Viewed: 126 times | Downloaded: 5 times

This Pack has no tags!

Creator

Pack myPack


Created: 2016-10-25 13:55:14 | Last updated: 2016-10-25 14:00:38

ok

1 item in this pack

Comments: 0 | Viewed: 20 times | Downloaded: 2 times

Tags:

Pack test


Created: 2016-10-19 06:56:02

test

0 items in this pack

Comments: 0 | Viewed: 14 times | Downloaded: 2 times

This Pack has no tags!

Creator

Pack KNIME workflows from Zdrazil et al, MedChemComm, 201...


Created: 2016-07-20 06:21:03 | Last updated: 2017-06-22 13:35:07

Included are 2 KNIME workflows for data retrieval and processing:1) a KNIME workflow called "Transporter_Profiling_SERT_DAT_HERGlabel" with HERG labels included2) a KNIME workflow called "Transporter_Profiling_SERT_DAT_Ki_IC50_tailored_TH" without HERG labels

7 items in this pack

Comments: 0 | Viewed: 34 times | Downloaded: 15 times

Tags:

Creator

Pack Telehealth Initiatives to Improve Efficiency and Qua...


Created: 2016-07-06 08:21:38

Over the past two decades, plenty of telehealth applications have been successfully implemented. Applications such as the transfer of digital photos and patient records and the use of medical video endoscopes to monitor patients’ physical examination have demonstrated great results. For many players, the introduction of telehealth in the global medical tourism market has been a profitable strategy.Telehealth improves the efficiency, customer service, and quality of medical tourism servi...

0 items in this pack

Comments: 0 | Viewed: 20 times | Downloaded: 4 times

Tags:

Creator

Pack Phenotypic screening annotation protocols


Created: 2016-05-06 12:02:23 | Last updated: 2016-05-06 12:03:03

This is a collection of all protocols published in Digles et al., Open PHACTS Computational Protocols for in silico Target validation of Cellular Phenotypic Screens: Knowing the Knowns, MedChemComm, submitted.The workflows require the Open PHACTS KNIME nodes (org.openphacts.utils.json_1.1.0.zip) available from https://github.com/openphacts/OPS-Knime.

3 items in this pack

Comments: 0 | Viewed: 96 times | Downloaded: 22 times

Tags:

Creator

Pack Experiment


Created: 2016-01-20 00:05:11

This is a test.

0 items in this pack

Comments: 0 | Viewed: 81 times | Downloaded: 12 times

This Pack has no tags!

Creator

Pack Dissertation-Ch4-SupplementaryMaterial


Created: 2015-11-17 15:24:18 | Last updated: 2015-11-17 15:46:20

This pack contains the workflow files in the Ch4 evaluation cohort. The result of abstraction, and the spreadsheet sources for the figures included in the evaluation section.

1 item in this pack

Comments: 0 | Viewed: 43 times | Downloaded: 7 times

This Pack has no tags!

Creator

Pack EBI_search


Created: 2015-09-30 09:39:30 | Last updated: 2015-09-30 09:44:37

eBI_search

2 items in this pack

Comments: 0 | Viewed: 41 times | Downloaded: 3 times

This Pack has no tags!

Creator

Pack Digital Scholarship: The Intersection of Disciplines


Created: 2015-09-25 17:41:40 | Last updated: 2015-09-25 17:42:20

Invited talk at Semantics Digital Humanities Workshop, 25th-27th of September 2015, New Seminar Room, St John’s College, University of Oxford, St Giles, OX1 3JP. Organized by Dept of Computer Science, e-Research Centre, and St John's College, University of Oxford.

1 item in this pack

Comments: 0 | Viewed: 1384 times | Downloaded: 5 times

This Pack has no tags!

Creator

Pack Pathway analysis with WikiPathways


Created: 2015-09-01 14:24:28 | Last updated: 2015-11-16 09:58:55

This pack contains workflows needed to perform pathway overrepresentation analysis based on the WikiPathways Web services.

8 items in this pack

Comments: 0 | Viewed: 38 times | Downloaded: 7 times

This Pack has no tags!

Creator

Pack Observing Social Machines Part 2: How to Observe?


Created: 2015-06-06 07:56:02 | Last updated: 2015-06-06 08:03:29

Paper for ACM WebSci15 by David De Roure, Clare Hooper, Kevin Page, Ségolène Tarte, and Pip Willcox. Copyright is held by the authors.

3 items in this pack

Comments: 0 | Viewed: 14 times | Downloaded: 0 times

This Pack has no tags!

Creator
Project Biovel

Pack Ecosystem modelling with Biome-BGC


Created: 2015-05-19 09:00:27 | Last updated: 2015-06-12 13:48:45

Brings together 5 workflows for ecosystem modelling and calculation of ecosystem service indicators. These workflows are developed around the Biome-BGC biogeochemical modelling software that simulates the storage and flux of water, carbon, and nitrogen between the ecosystem and the atmosphere, and within the components of the terrestrial ecosystems (Thornton, 2000).See descriptions of individual workflows for more details.The workflows in this pack have been created by the Biodiversity Virtua...

5 items in this pack

Comments: 0 | Viewed: 150 times | Downloaded: 40 times

Tags:

Creator

Pack Genotype-phenotype knowledge discovery using the Con...


Created: 2015-04-07 18:38:40 | Last updated: 2015-04-07 18:44:49

This pack compiles workflows and workflow results for the generation of literature-generated fingerprints of human phenotypes.

5 items in this pack

Comments: 0 | Viewed: 170 times | Downloaded: 21 times

Tags:

Creator

Pack TEI materiality text alignment for Now art thou soci...


Created: 2015-02-01 14:43:21 | Last updated: 2015-02-01 15:26:30

“now art thou sociable…now art thou what thou art”: Surfacing TEI Encoding in the Bodleian First Folio’s The Tragedy of Romeo and IulietPip Willcox and David De RoureAbstractThe Bodleian First Folio project has created digital editions of the 906 pages of text from this first edition of Shakespeare’s plays. The editions are transcribed and encoded in TEI P5-conformant XML. The Bodleian First Folio’s Web interface gives the reader access to digital images o...

11 items in this pack

Comments: 0 | Viewed: 46 times | Downloaded: 4 times

Tags:

Creator

Pack The Future of Scholarly Communications


Created: 2014-11-05 23:43:27 | Last updated: 2014-11-06 00:38:53

Original materials for article "The Future of Scholarly Communications" in Insights: the UKSG journal, based on a paper presented at the 37th UKSG Conference, Harrogate, April 2014.Citation - Please acknowledge Insights: the UKSG journal as the place of first publication.De Roure, D, The future of scholarly communications, Insights, 2014, 27(3), 233–238; DOI: http://dx.doi.org/10.1629/2048-7754.171AuthorDavid De RoureProfessor of e-Research, University of O...

5 items in this pack

Comments: 0 | Viewed: 11 times | Downloaded: 1 time

This Pack has no tags!

Pack Open PHACTS Drug Discovery FAQ Workflows


Created: 2014-11-05 11:12:18 | Last updated: 2014-11-05 11:15:59

Computational drug discovery using the KNIME workflow engine and the integrated resources of Open PHACTS for answering a number of important frequently asked pharmacology questions. 14 workflows for answering 16 different questions.

14 items in this pack

Comments: 0 | Viewed: 168 times | Downloaded: 39 times

Tags:

Creator

Pack RD-Connect D4.03 Deliverable Pack


Created: 2014-10-19 21:05:07 | Last updated: 2014-10-20 16:34:40

This pack compiles workflows and workflow results for Deliverable D4.03 for RD-Connect (http://rd-connect.eu).

5 items in this pack

Comments: 0 | Viewed: 44 times | Downloaded: 1 time

Tags:

Results per page:
Sort by: