Packs

Search filter terms
Filter by tag
Filter by user
Filter by licence
Filter by group
Results per page:
Sort by:
Showing 368 results. Use the filters on the left and the search box below to refine the results.
Creator

Pack Taverna 1.7 starter pack


Created: 2008-07-17 21:06:12 | Last updated: 2018-01-28 19:42:32

Everything to get started with Taverna 1.7 - latest version is 1.7.2

19 items in this pack

Comments: 0 | Viewed: 755 times | Downloaded: 268 times

Tags:

Creator

Pack Taverna 2.2 starter pack


Created: 2010-06-11 13:40:05 | Last updated: 2012-01-03 15:46:09

The Taverna team are pleased to announce that Taverna 2.2.0 workbench and command line tool are now available for users to download. Taverna 2.2.0 includes improvements to the workbench user interface and gives users greater control over the workflow engine.  Here are a few of the new features in the workbench:     * Loading and sharing of service sets     * Ability to load and edit workflows that contain services that are offline     ...

20 items in this pack

Comments: 0 | Viewed: 886 times | Downloaded: 213 times

Tags:

Creator

Pack Taverna 2.5 Enterprise Starter Pack


Created: 2014-04-02 12:54:33 | Last updated: 2017-01-09 12:01:51

This is a Starter Pack for Taverna 2.5 Enterprise edition - it contains a number of example workflows to showcase various features of Taverna 2.5 Enterprise and help you get started using it.Workflows from this Starter pack can also be found in the myExperiment perspective of the Taverna Workbench.Tutorials for Taverna are available under the Taverna 2.x documentation on the Taverna Web site.Also check out the Taverna User Manual.

18 items in this pack

Comments: 1 | Viewed: 236 times | Downloaded: 179 times

Tags:

Creator

Pack Taverna 2.4 starter pack


Created: 2012-03-18 13:43:06 | Last updated: 2013-10-08 12:49:44

Taverna 2.4.0 Workbench and Command Line Tool released   The Taverna team are pleased to announce that Taverna 2.4.0 Workbench and the Command Line Tool are now available for download.   Here are a number of new features in the Workbench: Text Constant service allowing easier entry of large textual values Greater control over what is return from REST service Ability to use all the example values for a workflow run with one button Easier annotation of serv...

20 items in this pack

Comments: 0 | Viewed: 837 times | Downloaded: 161 times

Tags:

Creator

Pack Paul Fisher workflows for benchmarks PR and CA2


Created: 2008-07-12 20:26:49 | Last updated: 2008-07-13 09:21:55

Please note that the workflows in this pack are not being maintained. For updated workflows check out http://www.myexperiment.org/users/43

77 items in this pack

Comments: 0 | Viewed: 359 times | Downloaded: 69 times

Tags:

Creator

Pack Taverna localworker example pack


Created: 2008-09-27 17:57:39 | Last updated: 2012-03-05 11:33:29

A pack of examples of the calling of Taverna's localworkers. The example workflows make extensive use of the default value mechanism for associating a value with a port of a service.  An alternative set of workflows that use string constants to make the values more explicit is under development.

103 items in this pack

Comments: 0 | Viewed: 436 times | Downloaded: 106 times

Tags:

Pack EMBL-EBI Web Services (retired)


Created: 2008-07-11 01:24:33 | Last updated: 2013-03-28 12:39:25

The European Bioinformatics Institiute offers a wide range of services covering may biological and bioinformatics domains. This Pack collates a set of workflows that provide wrappers for web services developed, and maintained by the EMBL-EBI.NB: the Web Services used in this package have been decommissioned and are no longer available. 

17 items in this pack

Comments: 0 | Viewed: 376 times | Downloaded: 75 times

Tags:

Creator

Pack Taverna 2.1 starter pack


Created: 2009-12-10 16:04:54 | Last updated: 2009-12-18 11:15:36

The Taverna team are happy to announce that Taverna 2.1 is now available for download. It includes many new features and bug fixes based on extensive usability reviews and hours of testing. 2.1 truly is the next release up from the 1.7.x line. 2.1 features:    * Copy/paste, shortcuts, undo/redo, drag and drop    * An Animated workflow diagram    * Remembers added/removed services    * Secure Web services support    * Up-to-da...

12 items in this pack

Comments: 0 | Viewed: 521 times | Downloaded: 237 times

Tags:

Pack Taverna 2.1 beta 2


Created: 2009-07-02 12:51:11 | Last updated: 2009-09-21 14:48:06

Taverna workbench 2.1 beta 2 Due to user response to Taverna 2 workbench, major improvements have been made to the user interface of Taverna 2.1 Beta 2 workbench.  Many of these are described below. Installing Choose your download from the list of links in this pack depending on your operating system. Windows If you have administrator rights on your machine, you can download the Windows installer (taverna-workbench-2.1.b2-installer.exe). A wizard should guide you thro...

6 items in this pack

Comments: 0 | Viewed: 179 times | Downloaded: 65 times

Tags:

Creator

Pack Example workflow for KEGG web service


Created: 2008-09-29 13:28:02 | Last updated: 2008-10-08 16:37:49

 The pack contains a number of test workflows for kegg web service (and operations)

14 items in this pack

Comments: 0 | Viewed: 430 times | Downloaded: 86 times

Tags:

Creator

Pack Core text mining workflows


Created: 2010-02-19 10:12:33 | Last updated: 2011-12-13 16:03:17

This pack contains workflows we have created to support core text mining tasks. We currently provide workflows to do these tasks Loading documents (text or PDF) PDF to text conversion Sentence splitting Text cleaning (ASCII or XML-valid) Term recognition (using NaCTeM service TerMine)  

7 items in this pack

Comments: 0 | Viewed: 727 times | Downloaded: 136 times

Tags:

Pack useful_for_sysmo


Created: 2008-12-17 12:31:48 | Last updated: 2009-06-10 09:43:20

These workflows have been collected as potentially useful protocols for the sysmo consortium

21 items in this pack

Comments: 0 | Viewed: 268 times | Downloaded: 53 times

Tags:

Creator

Pack Taverna 2.3 starter pack


Created: 2011-06-21 14:16:18 | Last updated: 2012-04-05 13:55:40

The Taverna team are pleased to announce that Taverna 2.3.0 Workbench and the Command Line Tool are now available for download. Taverna 2.3.0 includes new service types, integration with service catalogues and experimental export of provenance information. Here are a few of the new features in the Workbench: REST service allowing you to perform GET, POST, PUT and DELETE operations configured using a template XPath service where you can create an XPath expression from an example...

26 items in this pack

Comments: 0 | Viewed: 428 times | Downloaded: 67 times

Tags:

Creator

Pack Trident Example Workflows


Created: 2008-10-08 13:33:38 | Last updated: 2008-10-22 12:45:31

A set of example workflows for the Microsoft Trident workflow system

9 items in this pack

Comments: 0 | Viewed: 268 times | Downloaded: 70 times

Tags:

Creator

Pack Open Data: Bilateral Perisylvian Polymicrogyria


Created: 2010-11-16 16:20:43 | Last updated: 2011-09-23 10:55:08

This pack contains freely accessible data for scientific researchers to try and identify key genes linked to Bilateral Perisylvian Polymicrogyria. For those who want more information about this condition before they download the data, please see this link, which describes the condition and traits: http://omim.org/entry/300388?search=bilateral%20perisylvian%20polymicrogyria The results conatined within this pack are the output from running a scientific workflow that identifies candidate genes...

7 items in this pack

Comments: 0 | Viewed: 288 times | Downloaded: 50 times

Tags:

Creator

Pack WikiPathways workflows


Created: 2008-09-16 11:43:57 | Last updated: 2009-02-03 12:47:00

A set of workflows that use the WikiPathways webservice.

5 items in this pack

Comments: 0 | Viewed: 229 times | Downloaded: 54 times

Tags:

Creator
Project Biovel

Pack DEPRECATED - Matrix Population Models construction a...


Created: 2012-11-02 10:48:48 | Last updated: 2014-09-17 10:44:21

This pack is deprecated. To obtain a more recent version of this pack, please refer to: http://www.myexperiment.org/packs/483.html The Matrix Population Models Workflow provides an environment to create a stage-matrix with no density dependence and to perform several analyses on it:- Eigen analysis;- Age specific survival;- Generation time (T);- Net reproductive rate (Ro);- Transient Dynamics;- Bootstrap of observed census transitions (Confidence intervals of λ).This workflow has ...

4 items in this pack

Comments: 1 | Viewed: 180 times | Downloaded: 46 times

This Pack has no tags!

Creator

Pack acetanilide comparison study (test)


Created: 2008-08-18 17:58:31 | Last updated: 2008-08-18 18:11:21

Links to repository records, data files and Blog discussions for infra-red, hot stage microscopy, differential scanning calorimetry and x-ray crystallography studies on a small family of simple acetanilides

7 items in this pack

Comments: 0 | Viewed: 6842 times | Downloaded: 45 times

Tags:

Creator

Pack Pathway to Phenotype using Text Mining


Created: 2009-08-10 13:01:47 | Last updated: 2009-08-11 14:51:31

This pack contains a list of workflows and result files obtained from the analysis of candidate pathways believed to play a role in resistance to African Trypanosomiasis in the mouse model organism.

12 items in this pack

Comments: 0 | Viewed: 311 times | Downloaded: 88 times

Tags:

Creator

Pack Towards Genotype-Phenotype Correlations


Created: 2009-04-08 13:14:54 | Last updated: 2009-08-11 14:50:01

It is increasingly common to combine Microarray and Quantitative Trait Loci data to aid the search for candidate genes responsible for phenotypic variation. Workflows provide a means of systematically processing large datasets, and represent a framework for the re-use and the explicit declaration of experimental methods. In this pack is a paper which describes the issues facing the manual analysis of microarray and QTL data for the discovery of candidate genes underlying complex phenotypes.&n...

20 items in this pack

Comments: 0 | Viewed: 316 times | Downloaded: 82 times

Tags:

Creator

Pack AIDA demo pack


Created: 2008-12-14 21:35:43 | Last updated: 2009-05-01 17:35:26

 Pack with AIDA demo material

5 items in this pack

Comments: 0 | Viewed: 192 times | Downloaded: 0 times

Tags:

Creator

Pack Package: mapping oligonucleotides to an assembly


Created: 2008-12-11 12:02:47 | Last updated: 2009-01-22 09:06:26

This package contains all elements required to run the RShell use case "Mapping oligonucleotides to an assembly"  

5 items in this pack

Comments: 0 | Viewed: 253 times | Downloaded: 89 times

Tags:

Creator

Pack Everything You Need To Know About myExperiment...


Created: 2008-07-02 22:31:12 | Last updated: 2008-07-02 23:12:37

... but were afraid to ask. This is the pack to go to for all information about myExperiment and the people involved in this project!

9 items in this pack

Comments: 0 | Viewed: 320 times | Downloaded: 81 times

Tags:

Creator
Project Biovel

Pack Matrix Population Model construction and analysis pack


Created: 2013-08-13 14:31:09 | Last updated: 2015-06-12 13:48:43

This pack contains a workflow, a file and documentation (tutorial to run the workflow).The Matrix Population Models Workflow provides an environment for create a stage-matrix with no density dependence and perform several analyses on it.Analyses:Eigen analysis.Age specific survival.Generation time (T).Net reproductive rate (Ro).Transient Dynamics.Bootstrap of observed census transitions (Confidence intervals of λ).Survival curveKeyfitz’s ΔCohen’s cumulative distanceTh...

4 items in this pack

Comments: 0 | Viewed: 260 times | Downloaded: 73 times

Tags:

Creator

Pack Functional annotation of SNPs using next-generation ...


Created: 2012-06-26 10:41:38 | Last updated: 2015-09-01 14:31:18

This pack implements the concept profile matching pipeline in the knowledge discovery tool Anni (http://biosemantics.org/anni), and adapts it to interpret the top SNPs from a GWAS. The underlying literature and concept profile databases are the same as the for the current version of Anni (2.1). The pack consists of three main workflows (http://www.myexperiment.org/workflows/2999, http://www.myexperiment.org/workflows/2973, http://www.myexperiment.org/workflows/2972). Workflow 2999 returns a ...

12 items in this pack

Comments: 0 | Viewed: 206 times | Downloaded: 31 times

Tags:

Creator

Pack Who Wants to be a Data Miner?


Created: 2011-11-02 17:54:07 | Last updated: 2013-09-09 16:22:11

One of the most fun events at the annual RapidMiner Community Meeting and Conference (RCOMM) is the live data mining process design competition "Who Wants to be a Data Miner?". In this competition, participants must design RapidMiner processes for a given goal within a few minutes. The tasks are related to data mining and data analysis, but are rather uncommon. In fact, most of the challenges ask for things RapidMiner was never supposed to do. This pack contains solutions for these...

12 items in this pack

Comments: 0 | Viewed: 260 times | Downloaded: 142 times

Tags:

Creator

Pack Systematic integration of experimental data and mode...


Created: 2010-03-25 20:31:36 | Last updated: 2010-03-26 17:23:44

 A pack of workflows for the construction, parameterisation, optimisation and simulation of SBML models.

5 items in this pack

Comments: 0 | Viewed: 83 times | Downloaded: 0 times

Tags:

Creator

Pack Genotype to Pathway


Created: 2009-08-11 14:44:16 | Last updated: 2009-08-11 14:52:12

This pack is for investigating links between the genotype of an organisms to possible pathways. This constitutes half of the pathway-driven approach, genotype to pathway, and pathway to phenotype.

18 items in this pack

Comments: 0 | Viewed: 182 times | Downloaded: 51 times

Tags:

Creator

Pack FLOSS Research Analyses


Created: 2009-06-05 13:58:56 | Last updated: 2009-06-05 13:59:52

Workflows for analysis of free/libre open source software development.

5 items in this pack

Comments: 0 | Viewed: 115 times | Downloaded: 28 times

Tags:

Creator

Pack Taverna 2.1 beta 1 pack


Created: 2009-05-29 13:16:30 | Last updated: 2012-03-05 11:34:00

Introduction This is a pack for the first beta of Taverna 2.1 It includes a zip of Taverna 2.1 beta 1.  The zip includes the executable of Taverna 2.1 beta 1, some example files, release notes and a list of known issues.  If you have any comments or problems with the beta, then please post them as comments to this pack, or preferably to the taverna-hackers@lists.sourceforge.net Welcome to Taverna 2.1 Beta 1 workbench Due to user response to Taverna 2 workbench, major improveme...

2 items in this pack

Comments: 2 | Viewed: 90 times | Downloaded: 76 times

Tags:

Creator

Pack myExperiment paper for Concurrency Practice and Expe...


Created: 2009-04-10 13:41:56 | Last updated: 2009-04-14 08:38:09

This pack contains the materials used in the paper De Roure, D., Goble, C., Aleksejevs, S., Bechhofer, S., Bhagat, J., Cruickshank, D., Fisher, P., Hull, D., Michaelides, D., Newman, D., Procter, R., Lin, Y. and Poschen, M. (2009) Towards Open Science: The myExperiment approach. Concurrency and Computation: Practice and Experience. which has been submitted to the special issue of CCPE based on the Micorosfot e-Science workshop in Indianaopolis, December 2008. The paper uses a pack by Pail ...

8 items in this pack

Comments: 1 | Viewed: 258 times | Downloaded: 40 times

Tags:

Creator

Pack Carole's Keynotes


Created: 2008-09-27 19:52:17 | Last updated: 2010-05-08 20:24:47

Carole Goble's 2008 keynote talks that feature myExperiment, in PowerPoint 97-2003 format. All myExperiment presentation can be found on the wiki on http://wiki.myexperiment.org/index.php/Presentations  

5 items in this pack

Comments: 0 | Viewed: 752 times | Downloaded: 60 times

Tags:

Creator

Pack AIDA toolbox


Created: 2008-08-01 11:33:03 | Last updated: 2010-02-14 16:04:25

Adaptive Information Disclosure Application toolbox: AIDA web services for automated knowledge extraction and knowledge management Documentation    

9 items in this pack

Comments: 0 | Viewed: 251 times | Downloaded: 49 times

Tags:

Creator

Pack KNIME workflows and associated data from Koch et. al...


Created: 2017-06-29 17:26:00 | Last updated: 2017-12-19 10:19:21

The pack provides the KNIME workflows and associated data from:Koch M, Duigou T, Carbonell P, Faulon JL. Molecular structures enumeration and virtual screening in the chemical space with RetroPath2.0. Journal of Cheminformatics, 9:64, 2017. https://doi.org/10.1186/s13321-017-0252-9Please browse the linked packs below.

4 items in this pack

Comments: 0 | Viewed: 71 times | Downloaded: 32 times

Tags:

Creator

Pack Supporting material for paper: A putative role for g...


Created: 2013-11-06 10:34:47 | Last updated: 2017-04-19 11:22:27

This pack contains links that refer to the myExperiment packs and Research object links that describe our two sets of workflow implementation, for data analysis and for data interpretation. 

5 items in this pack

Comments: 0 | Viewed: 245 times | Downloaded: 12 times

This Pack has no tags!

Pack AstroTaverna Starter Pack


Created: 2013-04-12 16:10:31 | Last updated: 2013-11-27 16:54:39

This is a set of small snippets using AstroTaverna plugin, developed in the Wf4Ever project. The purpose of this pack is to make the design and development of astronomy Virtual Observatory workflows easier, learning by the example.AstroTaverna may be installed on Taverna 2.4 Workbenchhttp://wf4ever.github.io/astrotaverna/

29 items in this pack

Comments: 1 | Viewed: 177 times | Downloaded: 33 times

Tags:

Pack Visualize PAV provenance as SVG


Created: 2013-04-05 09:18:51 | Last updated: 2018-01-04 11:39:09

A workflow that converts PAV provenance to SVG by inferring PROV-O statements.VoID descriptions following the Open PHACTS Dataset descriptions specification are fetched as Turtle, cleaned up to be valid OWL2 ontology and include useful labels, processed through the OWL reasoner Pellet; this adds inferred PROV statements to the RDF, which is then fed to the PROV Toolbox, generating an SVG visualization of the provenance.Note that this workflow downloads CWM, Pellet and ProvToolbox on dema...

11 items in this pack

Comments: 0 | Viewed: 109 times | Downloaded: 24 times

Tags:

Pack e-LICO recommender workflows


Created: 2011-03-15 15:33:48 | Last updated: 2012-01-28 19:39:06

This pack contains recommender system workflows created for the purpose of e-LICO project.

6 items in this pack

Comments: 0 | Viewed: 306 times | Downloaded: 162 times

Tags:

Creator

Pack projekt v2


Created: 2009-06-08 11:12:52 | Last updated: 2009-06-17 14:34:18

Example project. It takes geographical coordinates and search target(ex. "pubs") to find them near the capital city of a country containing these coordinates.

6 items in this pack

Comments: 0 | Viewed: 26 times | Downloaded: 6 times

This Pack has no tags!

Creator

Pack Network Analysis


Created: 2009-06-05 14:01:31 | Last updated: 2009-06-05 14:01:56

Workflows that employ (social) network analysis.

3 items in this pack

Comments: 0 | Viewed: 86 times | Downloaded: 31 times

Tags:

Creator

Pack Metadata Management


Created: 2009-06-05 13:54:55 | Last updated: 2009-06-05 13:55:34

Workflows dealing with creating and updating metadata records.

3 items in this pack

Comments: 0 | Viewed: 66 times | Downloaded: 23 times

Tags:

Creator

Pack Supporting material for Roos et al., BMC Bioinformat...


Created: 2009-05-15 15:45:32 | Last updated: 2011-08-11 10:01:23

Supporting material for BMC Bioinformatics, supplement for Semantic Web Applications and Tools for Life Science (2009) Structuring and extracting knowledge for the support of hypothesis generation in molecular biology Marco Roos, M. Scott Marshall, Andrew P. Gibson, Martijn Schuemie, Edgar Meij, Sophia Katrenko, Willem Robert van Hage, Konstantinos Krommydas, Pieter W. Adriaans Acknowledgements We thank the myGrid team and OMII-UK for their support in applying their e-Science tools, and M...

5 items in this pack

Comments: 0 | Viewed: 152 times | Downloaded: 49 times

Tags:

Pack FunCUT package


Created: 2008-10-03 16:47:15 | Last updated: 2008-10-03 16:48:55

Input example and FunCUT workflow

1 item in this pack

Comments: 0 | Viewed: 166 times | Downloaded: 0 times

Tags:

Creator

Pack myExperiment Papers


Created: 2008-09-27 20:14:10 | Last updated: 2008-09-27 22:09:49

This pack contains all the myExperiment papers. They can also be found on the myExperiment Wiki on         http://wiki.myexperiment.org/index.php/Papers and are stored in ECS EPrints where they can be retrieved with this query         http://eprints.ecs.soton.ac.uk/cgi/search/advanced?projects=myexperiment

11 items in this pack

Comments: 0 | Viewed: 87 times | Downloaded: 20 times

This Pack has no tags!

Creator

Pack Newcastle NeuroScience


Created: 2008-08-04 17:35:59 | Last updated: 2008-09-01 17:00:14

This pack contains two PowerPoint presentations given at the 01/08/2008 Taverna and myExperiment tutorial.

3 items in this pack

Comments: 0 | Viewed: 122 times | Downloaded: 45 times

Tags:

Creator

Pack e-science tool pack


Created: 2008-08-01 10:52:42 | Last updated: 2008-08-01 12:06:07

Pack of tools and software components that can be used to enhance your research. 'e-science' characteristics: interoperabie with other tools free to use by academics components can be shared and reused, potentially for other means stimulating sharing and reusing components  

1 item in this pack

Comments: 0 | Viewed: 135 times | Downloaded: 41 times

Tags:

Creator

Pack Peter Li workflows for benchmarks PR and CA2


Created: 2008-07-13 20:32:39 | Last updated: 2008-07-13 20:47:19

Please note that the workflows in this pack are not being maintained. For updated workflows check out http://www.myexperiment.org/users/221

66 items in this pack

Comments: 0 | Viewed: 181 times | Downloaded: 27 times

Tags:

Creator

Pack Workflow discovery benchmarks


Created: 2008-07-12 11:20:23 | Last updated: 2008-10-09 16:41:46

This pack contains benchmarks that measure how bioinformaticians discover Taverna workflows. Several subpacks are available: Collection of workflows by Paul Fisher, used in benchmarks PR2 and CA2 Collection of workflows by Peter Li, used in benchmarks PR2 and CA2  

7 items in this pack

Comments: 0 | Viewed: 171 times | Downloaded: 51 times

Tags:

Creator

Pack web services info


Created: 2008-07-02 17:15:34 | Last updated: 2008-07-13 23:00:16

This pack contains useful info related to bio services.

6 items in this pack

Comments: 0 | Viewed: 126 times | Downloaded: 26 times

Tags:

Creator

Pack Pack #4 - Metabolome completion and metabolomics


Created: 2017-06-30 16:36:44 | Last updated: 2017-12-19 10:22:42

This pack provides part of the supporting material for:Koch M, Duigou T, Carbonell P, Faulon JL. Molecular structures enumeration and virtual screening in the chemical space with RetroPath2.0. Journal of Cheminformatics, 9:64, 2017. https://doi.org/10.1186/s13321-017-0252-9The pack contains (i) the RetroPath2.0-Mods-metabolomics workflow as well as (ii) all the associated data for the metabolome completion use case (see the main text for details, section 2.4 Metabolome completion and metabolo...

2 items in this pack

Comments: 0 | Viewed: 67 times | Downloaded: 22 times

Tags:

Creator

Pack Pack #3 - Search for molecules maximizing biological...


Created: 2017-06-30 16:33:44 | Last updated: 2017-12-19 10:22:03

This pack provides part of the supporting material for:Koch M, Duigou T, Carbonell P, Faulon JL. Molecular structures enumeration and virtual screening in the chemical space with RetroPath2.0. Journal of Cheminformatics, 9:64, 2017. https://doi.org/10.1186/s13321-017-0252-9The pack contains (i) the RetroPath2.0-Mods-iQSAR workflow for the search of molecules of interest, (ii) the QSAR-model-aminoglycosides workflow that build a QSAR model for predicting the antibacterial activity, and (iii) t...

3 items in this pack

Comments: 0 | Viewed: 65 times | Downloaded: 26 times

Tags:

Creator

Pack Pack #2 - Isomer enumeration (isomer transformation ...


Created: 2017-06-30 16:31:31 | Last updated: 2017-12-19 10:21:41

This pack provides part of the supporting material for:Koch M, Duigou T, Carbonell P, Faulon JL. Molecular structures enumeration and virtual screening in the chemical space with RetroPath2.0. Journal of Cheminformatics, 9:64, 2017. https://doi.org/10.1186/s13321-017-0252-9The pack contains (i) the RetroPath2.0-Mods-isomer-transformation worklfow, (ii) data for the enumeration of alkane isomers using the isomer transformation algorithm (see the main text for details, section 2.1 Isomer enumer...

5 items in this pack

Comments: 0 | Viewed: 74 times | Downloaded: 23 times

Tags:

Creator

Pack Pack #1 - Isomer enumeration (canonical augmentation...


Created: 2017-06-30 16:29:21 | Last updated: 2017-12-19 10:20:58

This pack provides part of the supporting material for:Koch M, Duigou T, Carbonell P, Faulon JL. Molecular structures enumeration and virtual screening in the chemical space with RetroPath2.0. Journal of Cheminformatics, 9:64, 2017. https://doi.org/10.1186/s13321-017-0252-9The pack contains the (i) RetroPath2.0-Mods-isomer-augmentation worklfow as well as (ii) the associated data for the enumeration of isomers using the canonical augmentation algorithm (see the main text for details, section ...

2 items in this pack

Comments: 0 | Viewed: 91 times | Downloaded: 26 times

Tags:

Creator

Pack Taverna 2.5 Core Starter Pack


Created: 2014-04-02 11:32:18 | Last updated: 2017-01-09 13:09:40

This is a Starter Pack for Taverna 2.5 Core edition - it contains a number of example workflows to showcase various features of Taverna 2.5 Core and help you get started using it.Workflows from this Starter pack can also be found in the myExperiment perspective of the Taverna Workbench.Tutorials for Taverna are available under the Taverna 2.x documentation on the Taverna Web site.Also check out the Taverna User Manual.

14 items in this pack

Comments: 0 | Viewed: 106 times | Downloaded: 33 times

Tags:

Creator
Project Biovel

Pack Matrix Population Models analyses pack


Created: 2013-08-14 10:37:55 | Last updated: 2014-07-25 10:56:14

This pack contains a workflow, a file and documentation (tutorial to run the workflow).The Matrix Population Models Workflow provides an environment  to perform several analyses on a stage-matrix with no density dependence:Eigen analysis.Age specific survival.Generation time (T).Net reproductive rate (Ro).Transient Dynamics.Resample a projection matrix (Confidence intervals of λ).Survival curveKeyfitz’s ΔCohen’s cumulative distance This workflow has bee...

3 items in this pack

Comments: 0 | Viewed: 115 times | Downloaded: 49 times

Tags:

Creator
Project Biovel

Pack Integral Projection Models pack


Created: 2013-08-13 12:51:30 | Last updated: 2015-06-12 13:48:44

This pack contains a workflow, a file and documentation (tutorial to run the workflow).The Integral Projection Model (IPM) Workflow provides an environment for create an integral projection model and to calculate its population growth, structure, sensitivities and elasticities analyses, age-specific metrics, etc.Create an IPM with no density dependence and perform several analyses on it.Analyses:Lambda (λ).Sensitivity analysis.Elasticity analysis.Parameters elasticity and sensitivity o...

3 items in this pack

Comments: 0 | Viewed: 146 times | Downloaded: 56 times

Tags:

Creator

Pack Concept profile analysis using Anni Web services


Created: 2013-02-06 19:11:26 | Last updated: 2014-07-15 08:17:33

Concept profile analysis is a knowledge discovery method that proved successful in generating hypotheses about molecular mechanisms explaining the results from genotype-phenotype studies. This technology has been implemented in the Anni standalone application (http://biosemantics.org/anni). This pack contains a number of workflows that can be used together to configure and run typical user pipelines from Anni through the Anni Web services (http://www.biocatalogue.org/services/3559).

11 items in this pack

Comments: 0 | Viewed: 134 times | Downloaded: 28 times

Tags:

Creator

Pack Recommender systems workflow templates 2012


Created: 2012-01-08 12:27:43 | Last updated: 2012-06-03 19:48:22

 The Recommender Extension can be downloaded from the Rapid-I Marketplace from: http://rapidupdate.de:8180/UpdateServer/faces/product_details.xhtml?productId=rmx_irbrecommender . More details can be found: http://elico.rapid-i.com/recommender-extension.html          

12 items in this pack

Comments: 0 | Viewed: 478 times | Downloaded: 145 times

Tags:

Creator

Pack Presentation - Socialising e-Science


Created: 2009-12-13 11:01:20 | Last updated: 2011-06-28 17:27:44

Title: Socialising e-Science Speaker: David De Roure Event: IEEE e-Science 2009 Event URL: http://www.escience2009.org/ Location: Oxford, UK Date: Tuesday December 8, 2009 Formats: .ppt and .pptx

3 items in this pack

Comments: 0 | Viewed: 84 times | Downloaded: 18 times

This Pack has no tags!

Creator

Pack Presentation - Lessons from myExperiment: Two insigh...


Created: 2009-12-13 10:58:37 | Last updated: 2009-12-13 11:06:19

Title: Lessons from myExperiment: Two insights into emerging e-Research practice Speaker: David De Roure Event: UK e-Science All Hands Meeting 2009 Event URL: http://www.allhands.org.uk/ Location: Oxford, UK Date: Monday December 7, 2009 Formats: .ppt and .pptx

2 items in this pack

Comments: 0 | Viewed: 79 times | Downloaded: 19 times

This Pack has no tags!

Creator

Pack Portugal Tutorial November 2009


Created: 2009-11-14 17:14:46 | Last updated: 2009-11-16 14:09:29

This is a pack containing all files for the collaborative team-building workflow exercise. 

8 items in this pack

Comments: 0 | Viewed: 77 times | Downloaded: 0 times

Tags:

Creator

Pack Presentation - Lessons from myExperiment: Research O...


Created: 2009-10-16 22:44:26 | Last updated: 2009-10-16 22:46:17

Title: Lessons from myExperiment: Research Objects for Data Intensive Research Speaker: David De Roure Event: Bio Microsoft e-Science 2009 Workshop Event URL: http://research.microsoft.com/en-us/events/escience2009/ Location: Pittsburgh, US Date: Friday, October 16, 2009 Formats: .ppt and .pptx    

2 items in this pack

Comments: 0 | Viewed: 53 times | Downloaded: 18 times

This Pack has no tags!

Creator

Pack Taverna 2 workflow example and associated provenance


Created: 2009-09-10 14:21:53 | Last updated: 2009-09-10 14:22:33

test workflow along with a raw provenance dump which can be imported into mySQL

2 items in this pack

Comments: 0 | Viewed: 57 times | Downloaded: 20 times

Tags:

Creator

Pack BioExtract Server Workflow Tutorial


Created: 2009-08-07 16:04:23 | Last updated: 2009-08-07 16:23:53

A tutorial to demonstrate how to create a workflow within the BioExtract Server at bioextract.org. Specifically, it shows how to perform a phylogenetic analysis on a set of proteins where the starting point is a query for specific nucleotide gene sequences.

1 item in this pack

Comments: 0 | Viewed: 117 times | Downloaded: 37 times

Tags:

Creator

Pack Presentation - myExperiment: Towards Research Objects


Created: 2009-07-14 09:55:39 | Last updated: 2011-08-17 13:04:48

Title: myExperiment: Towards Research Objects Speaker: David De Roure Event: DReSNet Workshop on Repositories and Biological Medical Applications Event URI: http://www.dresnet.net/ Location: Manchester, UK Date: Tuesday, July 14, 2009 Formats: .ppt  

1 item in this pack

Comments: 0 | Viewed: 58 times | Downloaded: 18 times

This Pack has no tags!

Creator

Pack Presentation - Where are we going and how are we goi...


Created: 2009-07-10 23:39:07 | Last updated: 2009-07-10 23:52:56

Title: Where are we going and how are we going to get there Speaker: David De Roure Event: JISC Projects start-up meeting Information Environment 2009-11 & Virtual Research Environment Event URI: http://www.jisc.ac.uk/whatwedo/programmes/inf11/inf11startup.aspx Location: Leicester, UK Date: Tuesday, July 7, 2009 Formats: .ppt  

2 items in this pack

Comments: 0 | Viewed: 46 times | Downloaded: 15 times

This Pack has no tags!

Creator

Pack Presentation - Social Networking and Workflows in Re...


Created: 2009-06-09 14:18:16 | Last updated: 2009-06-09 14:24:02

Title: Social Networking and Workflows in Research Speaker: David De Roure Event: Leaping Hurdles: Planning IT Provision for Researchers Event URI: http://www.nesc.ac.uk/esi/events/974/ Location: Edinburgh, UK Date: Tuesday, June 9, 2009 Formats: .ppt Notes: this event is being held in Edinburgh and then again in London  

1 item in this pack

Comments: 0 | Viewed: 61 times | Downloaded: 26 times

This Pack has no tags!

Creator

Pack Presentation - The Experiment that is myExperiment


Created: 2009-06-08 23:32:06 | Last updated: 2009-06-08 23:34:36

Title: The Experiment that is myExperiment Speaker: Carole Goble Event: Group 09 Event URI: http://www.group2009conference.com/ Location: Sanibel Island, Florida, USA Date: Monday, May 11, 2009 Formats: .ppt Abstract: myExperiment (http://www.myexperiment.org) is a community repository and virtual research environment that supports the sharing and reuse of scientific workflows and (increasingly) other kinds of experiment plans and methods. For researchers it provides a social infr...

1 item in this pack

Comments: 0 | Viewed: 58 times | Downloaded: 20 times

This Pack has no tags!

Creator

Pack AIDA remote runners


Created: 2009-05-15 16:08:03 | Last updated: 2009-05-15 16:11:20

Runners for AIDA demonstrations and testing

2 items in this pack

Comments: 0 | Viewed: 65 times | Downloaded: 35 times

Tags:

Creator

Pack Soils of western Wright Valley, Antarctica


Created: 2009-04-30 23:02:49 | Last updated: 2009-04-30 23:06:43

Soil profile descriptions and photographs of Soils of western Wright Valley, Antarctica. Supports Antarctic Science paper titled Soils of western Wright Valley, Antarctica to be published shortly.

1 item in this pack

Comments: 0 | Viewed: 51 times | Downloaded: 21 times

Tags:

Creator

Pack A test pack of stuff


Created: 2009-02-09 16:33:33 | Last updated: 2009-02-09 16:34:03

Testing what I can do with packs.

1 item in this pack

Comments: 0 | Viewed: 49 times | Downloaded: 29 times

Tags:

Creator

Pack Delete unwanted DNA from plasmids


Created: 2009-02-04 06:34:43 | Last updated: 2009-02-04 15:47:23

  psg5 (for HEG0 ERa, EcoR1): https://www.lablife.org/pglabs?f=c&cmd=viewvecseq&vectorid=3768 1021 GTAATACGACTCACTATAGGGCG AATT CGGATCCAGATCTTATTAAAGCA GAACTTGTTT Forward: 5'-ATACGACTCACTATAGGGCGCGGATCCAGATCTTAT-3' (20, 16) Reverse: 5'-TAATAAGATCTGGATCCGCGCCCTATAGTGAGTCG-3' (18, 17)   pGL2 (for p15 4xSBR1, kpn1, insert: 160 bp): https://www.lablife.org/pglabs?f=c&cmd=viewvecseq&vectorid=3345 1 cccgggaggtaccgagctcttacgcgtgct agctcgagat ctaagtaagc 5551 ccaaactc...

0 items in this pack

Comments: 0 | Viewed: 44 times | Downloaded: 8 times

This Pack has no tags!

Creator

Pack OMERO.editor example files


Created: 2008-10-07 12:48:42 | Last updated: 2008-10-07 12:54:32

OMERO.editor is a tool for metadata editing. see the website for more details.

3 items in this pack

Comments: 0 | Viewed: 52 times | Downloaded: 13 times

This Pack has no tags!

Creator

Pack Example workflows for annotated web services


Created: 2008-09-29 11:57:45 | Last updated: 2008-09-29 13:34:14

The pack contains a number of test workflows i built when i'm annotating web services. The workflows (one or two services) have all example parameters. Cool, now you can test some web services before add them to your workflows. Do you have any workflows you built to test a service? please add them to the pack. List of myGrid annotated web services:  http://www.mygrid.org.uk/feta/mygrid/descriptions/  

1 item in this pack

Comments: 0 | Viewed: 85 times | Downloaded: 29 times

Tags:

Creator

Pack Testing456


Created: 2008-07-12 08:42:06 | Last updated: 2008-07-12 08:43:01

subpack 1

1 item in this pack

Comments: 0 | Viewed: 35 times | Downloaded: 0 times

This Pack has no tags!

Creator

Pack Testing123


Created: 2008-07-12 08:33:53 | Last updated: 2008-07-12 08:44:11

A pack that has packs

4 items in this pack

Comments: 0 | Viewed: 38 times | Downloaded: 12 times

This Pack has no tags!

Creator

Pack Isosteric transform library


Created: 2020-04-27 13:23:39 | Last updated: 2020-04-27 13:29:56

This Isostere pack contains files where isosteric transforms have been generated from a variety of sources and equivalent chemical descriptors.For example one can generate a measure of CDK molecular complexity (branching and ring order add complexity) and then find fragments , frequently occurring R-groups or small molecules that have same value. This naturally leads to well known isosteres, amongst others.

1 item in this pack

Comments: 0 | Viewed: 111 times | Downloaded: 9 times

Tags:

Creator

Pack Test


Created: 2019-10-03 17:23:53

Test

0 items in this pack

Comments: 0 | Viewed: 25 times | Downloaded: 5 times

Tags:

Creator

Pack IBISBA workflows


Created: 2018-01-28 19:40:56 | Last updated: 2018-01-28 19:43:39

Initial set of IBISBA WP7 workflows

2 items in this pack

Comments: 0 | Viewed: 13 times | Downloaded: 8 times

This Pack has no tags!

Creator

Pack Selenzyme


Created: 2017-08-18 08:23:47 | Last updated: 2017-08-23 11:12:00

Enzyme selection workflow for pathway design

2 items in this pack

Comments: 0 | Viewed: 49 times | Downloaded: 24 times

Tags:

Creator

Pack Workflows for scaffold trend analyses


Created: 2017-06-22 13:01:47 | Last updated: 2018-06-14 09:37:37

These two KNIME workflows were used to process the raw data (retrieved via sql query from ChEMBL) in order to retrieve the final data for scaffold trend analyses as described in the paper: "The rise and fall of a scaffold: A trend analysis of scaffolds in the medicinal chemistry literature" by B. Zdrazil and R. Guha, Journal of Medicinal Chemistry, 2018, 61 (11), pp 4688-4703.

2 items in this pack

Comments: 0 | Viewed: 42 times | Downloaded: 24 times

Tags:

Pack Open research data reutilization tool


Created: 2017-01-20 16:44:15 | Last updated: 2017-03-15 07:30:53

Workflows created in order to perform a machine learning project using open research data from the Harvard Dataverse. This work is the result of my master's thesis and you are very welcome to collaborate!

4 items in this pack

Comments: 0 | Viewed: 35 times | Downloaded: 4 times

This Pack has no tags!

Creator

Pack Supplementary information for paper submission @ F10...


Created: 2016-10-25 14:57:58 | Last updated: 2016-10-25 15:06:18

This pack contains the files that belong to supplementary information of the paper submission at F1000Research. Note: This is a temporary link for the review proccess of the thesis "Knowledge discovery methods in Huntington's Disease" by Eleni Mina, till the data are published online at the F1000Research

5 items in this pack

Comments: 0 | Viewed: 126 times | Downloaded: 5 times

This Pack has no tags!

Creator

Pack myPack


Created: 2016-10-25 13:55:14 | Last updated: 2016-10-25 14:00:38

ok

1 item in this pack

Comments: 0 | Viewed: 20 times | Downloaded: 2 times

Tags:

Pack test


Created: 2016-10-19 06:56:02

test

0 items in this pack

Comments: 0 | Viewed: 14 times | Downloaded: 2 times

This Pack has no tags!

Creator

Pack KNIME workflows from Zdrazil et al, MedChemComm, 201...


Created: 2016-07-20 06:21:03 | Last updated: 2017-06-22 13:35:07

Included are 2 KNIME workflows for data retrieval and processing:1) a KNIME workflow called "Transporter_Profiling_SERT_DAT_HERGlabel" with HERG labels included2) a KNIME workflow called "Transporter_Profiling_SERT_DAT_Ki_IC50_tailored_TH" without HERG labels

7 items in this pack

Comments: 0 | Viewed: 35 times | Downloaded: 15 times

Tags:

Creator

Pack Telehealth Initiatives to Improve Efficiency and Qua...


Created: 2016-07-06 08:21:38

Over the past two decades, plenty of telehealth applications have been successfully implemented. Applications such as the transfer of digital photos and patient records and the use of medical video endoscopes to monitor patients’ physical examination have demonstrated great results. For many players, the introduction of telehealth in the global medical tourism market has been a profitable strategy.Telehealth improves the efficiency, customer service, and quality of medical tourism servi...

0 items in this pack

Comments: 0 | Viewed: 20 times | Downloaded: 4 times

Tags:

Creator

Pack Phenotypic screening annotation protocols


Created: 2016-05-06 12:02:23 | Last updated: 2016-05-06 12:03:03

This is a collection of all protocols published in Digles et al., Open PHACTS Computational Protocols for in silico Target validation of Cellular Phenotypic Screens: Knowing the Knowns, MedChemComm, submitted.The workflows require the Open PHACTS KNIME nodes (org.openphacts.utils.json_1.1.0.zip) available from https://github.com/openphacts/OPS-Knime.

3 items in this pack

Comments: 0 | Viewed: 96 times | Downloaded: 22 times

Tags:

Creator

Pack Experiment


Created: 2016-01-20 00:05:11

This is a test.

0 items in this pack

Comments: 0 | Viewed: 81 times | Downloaded: 12 times

This Pack has no tags!

Creator

Pack Dissertation-Ch4-SupplementaryMaterial


Created: 2015-11-17 15:24:18 | Last updated: 2015-11-17 15:46:20

This pack contains the workflow files in the Ch4 evaluation cohort. The result of abstraction, and the spreadsheet sources for the figures included in the evaluation section.

1 item in this pack

Comments: 0 | Viewed: 43 times | Downloaded: 7 times

This Pack has no tags!

Creator

Pack EBI_search


Created: 2015-09-30 09:39:30 | Last updated: 2015-09-30 09:44:37

eBI_search

2 items in this pack

Comments: 0 | Viewed: 41 times | Downloaded: 3 times

This Pack has no tags!

Creator

Pack Digital Scholarship: The Intersection of Disciplines


Created: 2015-09-25 17:41:40 | Last updated: 2015-09-25 17:42:20

Invited talk at Semantics Digital Humanities Workshop, 25th-27th of September 2015, New Seminar Room, St John’s College, University of Oxford, St Giles, OX1 3JP. Organized by Dept of Computer Science, e-Research Centre, and St John's College, University of Oxford.

1 item in this pack

Comments: 0 | Viewed: 1384 times | Downloaded: 5 times

This Pack has no tags!

Creator

Pack Pathway analysis with WikiPathways


Created: 2015-09-01 14:24:28 | Last updated: 2015-11-16 09:58:55

This pack contains workflows needed to perform pathway overrepresentation analysis based on the WikiPathways Web services.

8 items in this pack

Comments: 0 | Viewed: 38 times | Downloaded: 7 times

This Pack has no tags!

Creator

Pack Observing Social Machines Part 2: How to Observe?


Created: 2015-06-06 07:56:02 | Last updated: 2015-06-06 08:03:29

Paper for ACM WebSci15 by David De Roure, Clare Hooper, Kevin Page, Ségolène Tarte, and Pip Willcox. Copyright is held by the authors.

3 items in this pack

Comments: 0 | Viewed: 14 times | Downloaded: 0 times

This Pack has no tags!

Creator
Project Biovel

Pack Ecosystem modelling with Biome-BGC


Created: 2015-05-19 09:00:27 | Last updated: 2015-06-12 13:48:45

Brings together 5 workflows for ecosystem modelling and calculation of ecosystem service indicators. These workflows are developed around the Biome-BGC biogeochemical modelling software that simulates the storage and flux of water, carbon, and nitrogen between the ecosystem and the atmosphere, and within the components of the terrestrial ecosystems (Thornton, 2000).See descriptions of individual workflows for more details.The workflows in this pack have been created by the Biodiversity Virtua...

5 items in this pack

Comments: 0 | Viewed: 150 times | Downloaded: 40 times

Tags:

Creator

Pack Genotype-phenotype knowledge discovery using the Con...


Created: 2015-04-07 18:38:40 | Last updated: 2015-04-07 18:44:49

This pack compiles workflows and workflow results for the generation of literature-generated fingerprints of human phenotypes.

5 items in this pack

Comments: 0 | Viewed: 170 times | Downloaded: 21 times

Tags:

Creator

Pack TEI materiality text alignment for Now art thou soci...


Created: 2015-02-01 14:43:21 | Last updated: 2015-02-01 15:26:30

“now art thou sociable…now art thou what thou art”: Surfacing TEI Encoding in the Bodleian First Folio’s The Tragedy of Romeo and IulietPip Willcox and David De RoureAbstractThe Bodleian First Folio project has created digital editions of the 906 pages of text from this first edition of Shakespeare’s plays. The editions are transcribed and encoded in TEI P5-conformant XML. The Bodleian First Folio’s Web interface gives the reader access to digital images o...

11 items in this pack

Comments: 0 | Viewed: 46 times | Downloaded: 4 times

Tags:

Creator

Pack The Future of Scholarly Communications


Created: 2014-11-05 23:43:27 | Last updated: 2014-11-06 00:38:53

Original materials for article "The Future of Scholarly Communications" in Insights: the UKSG journal, based on a paper presented at the 37th UKSG Conference, Harrogate, April 2014.Citation - Please acknowledge Insights: the UKSG journal as the place of first publication.De Roure, D, The future of scholarly communications, Insights, 2014, 27(3), 233–238; DOI: http://dx.doi.org/10.1629/2048-7754.171AuthorDavid De RoureProfessor of e-Research, University of O...

5 items in this pack

Comments: 0 | Viewed: 11 times | Downloaded: 1 time

This Pack has no tags!

Pack Open PHACTS Drug Discovery FAQ Workflows


Created: 2014-11-05 11:12:18 | Last updated: 2014-11-05 11:15:59

Computational drug discovery using the KNIME workflow engine and the integrated resources of Open PHACTS for answering a number of important frequently asked pharmacology questions. 14 workflows for answering 16 different questions.

14 items in this pack

Comments: 0 | Viewed: 168 times | Downloaded: 39 times

Tags:

Creator

Pack RD-Connect D4.03 Deliverable Pack


Created: 2014-10-19 21:05:07 | Last updated: 2014-10-20 16:34:40

This pack compiles workflows and workflow results for Deliverable D4.03 for RD-Connect (http://rd-connect.eu).

5 items in this pack

Comments: 0 | Viewed: 44 times | Downloaded: 1 time

Tags:

Results per page:
Sort by: