User: Prateek

Name: Prateek

Joined: Wednesday 10 March 2010 09:53:56 (UTC)

Last seen: Tuesday 30 July 2013 15:45:23 (UTC)

Email (public): prateekrai2006 [at] yahoo.co.in

Website: Not specified

Location: New delhi, India

0 Friends

0 Groups (admin)

0 Groups (member)

1 Workflows

0 Favourites

Prateek has been credited 1 time

Prateek has an average rating of:

0.0 / 5

(0 ratings in total)

for their items

Description/summary not set

Other contact details:

Not specified

Interests:

Not specified

Field/Industry: Bioinformatics

Occupation/Role(s): Project Trainee

Organisation(s):

Unit of Simulation & Informatics,
Indian Agricultural Research Institute,
PUSA,New Delhi

Note: some items may not be visible to you, due to viewing permissions.

Workflow

Taverna 2

Uploader

Prateek

Nucleotide FASTA to PDB file. (1)

Download

This workflow is designed to convert nucleotide fasta sequence to corresponding pdb file,which could be used for modelling. In this workflow nucleotide fasta sequence is given as input, eg. >gi|119889797|ref|XM_864887.2| PREDICTED: Bos taurus amylase, alpha 2A (pancreatic), transcript variant 2 (AMY2A), mRNA ATGAAGTTTTTTCTGTTGCTTTCAGCAATTGGGTTCTGCTGGGCTCAGTATGACCCACACGTCAAATCTG GACGGACCTCCATTGTCCATCTGTTTGAGTGGCGCTGGGTAGATATTGCTCTTGAATGTGAGCGATACTT AGCCCCCAAAGGATTTGGAGGGGTTCAGGTCTCCCCAC...

Created: 2010-06-11 | Last updated: 2010-06-11

Credits: Prateek

What is this?

Linked Data

Non-Information Resource URI:

Alternative Formats