1. Home

All content

Search filter terms
Filter by category
File
1243
Pack
368
Filter by type
XML
109
Filter by tag
Filter by user
Filter by licence
by-sa
3227
by
355
Filter by group
Filter by wsdl
Filter by curation
Results per page:
Sort by:
Showing 4527 results. Use the filters on the left and the search box below to refine the results.
Kepler
Uploader
Avatar Leidou

Workflow Statistic_creation (1)

The workflow make statistic of meteorological data from one weather station. It's used to show how to creation syntax is used in the comad path expression.

Created: 2010-06-15 | Last updated: 2010-06-15

Credits: User Leidou

Kepler
Uploader
Avatar Leidou

Workflow Statistic_CompositeCoactor (1)

The workflow make statistic of meteorological data from one weather station. It's used to show how to use comad composite coactor.

Created: 2010-06-15 | Last updated: 2010-06-15

Credits: User Leidou

Kepler
Uploader
Avatar Leidou

Workflow Statistic (1)

The workflow make statistic of meteorological data from one weather station. It shows generally how  a comad workflow is built up.

Created: 2010-06-15 | Last updated: 2010-06-15

Credits: User Leidou

Kepler
Uploader
Avatar Leidou

Workflow two_station_RPlotter (1)

Comet workflow analyzes meteorological data coming from comet project (http://comet.ucdavis.edu/wiki/index.php/Main_Page). The main analysis steps are: 1.Collect hourly humidity data in ten days from two weather stations 2.Aggregate the hourly data based on a group of time window and calculate basic statistic data, like min, max etc, for the data aggregated in each window. 3.Calculate statistics of growing degree day for data in each window 4.Draw time-based trend graph for analysis and...

Created: 2010-06-15 | Last updated: 2010-06-15

Credits: User Leidou

Kepler
Uploader
Avatar Leidou

Workflow three_station_RPlotter (1)

Comet workflow analyzes meteorological data coming from comet project (http://comet.ucdavis.edu/wiki/index.php/Main_Page). The main analysis steps are: 1.Collect hourly humidity data in ten days from three weather stations 2.Aggregate the hourly data based on a group of time window and calculate basic statistic data, like min, max etc, for the data aggregated in each window. 3.Calculate statistics of growing degree day for data in each window 4.Draw time-based trend graph for analysis a...

Created: 2010-06-15 | Last updated: 2010-06-15

Credits: User Leidou

Kepler
Uploader
Avatar Leidou

Workflow one_station_SequencePlotter (1)

Comet workflow analyzes meteorological data coming from comet project (http://comet.ucdavis.edu/wiki/index.php/Main_Page). The main analysis steps are: 1.Collect hourly humidity data in ten days from one weather station 2.Aggregate the hourly data based on a group of time window and calculate basic statistic data, like min, max etc, for the data aggregated in each window. 3.Calculate statistics of growing degree day for data in each window 4.Draw time-based trend graph for analysis...

Created: 2010-06-15 | Last updated: 2010-06-15

Credits: User Leidou

Kepler
Uploader
Avatar Leidou

Workflow one_station_RPlotter (1)

The workflow analyzes meteorological data coming from comet project (http://comet.ucdavis.edu/wiki/index.php/Main_Page). The main analysis steps are: 1. Collect hourly humidity data in ten days from one weather station 2. Aggregate the hourly data based on a group of time window and calculate basic statistic data, like min, max etc, for the data aggregated in each window. 3. Calculate statistics of growing degree day for data in each window 4. Draw time-based trend graph for analy...

Created: 2010-06-15 | Last updated: 2010-06-15

Credits: User Leidou

Creator
Avatar Leidou
Show View Download Download

Pack comad comet demo workflow


Created: 2010-06-15 18:31:20 | Last updated: 2010-06-15 19:23:27

It contains workflows to demonstrate  the neat linear workflow structure got from comad. And the streaming mode and high adaptability (reusability) of the actor to the workflow with different data structure are also showed.

4 items in this pack

Comments: 0 | Viewed: 61 times | Downloaded: 30 times

Tags:
Creator
3222?size=60x60 Gb Sean Bechhofer
Show View Download Download

Pack Presentation: SKOS, Past, Present and Future


Created: 2010-06-15 11:18:56 | Last updated: 2010-07-17 08:22:00

Title: SKOS, Past, Present and Future Speaker: Sean Bechhofer Event: Extended Semantic Web Conference, ESWC 2010 Event URL: http://www.escw2010.org Location: Crete Date: Thursday, Jun 3rd, 2010

3 items in this pack

Comments: 0 | Viewed: 38 times | Downloaded: 14 times

Tags:
RapidMiner
Uploader
2441?size=60x60 Fr Haddock

Workflow Function finding (1)

Thumb
This process recursively generates new attributes by mathematically combining existing attributes with user selectable operators. At the end of each pass through the recursion attributes are thinned to prevent silicon smoke and unpleasantness. Sample input. P1    P2    A1    A2    RESULT 2       3      4      5      15 6     &...

Created: 2010-06-12 | Last updated: 2010-06-29

Taverna 2
Uploader
1827?size=60x60 In Prateek

Workflow Nucleotide FASTA to PDB file. (1)

Thumb
This workflow is designed to convert nucleotide fasta sequence to corresponding pdb file,which could be used for modelling. In this workflow nucleotide fasta sequence is given as input, eg. >gi|119889797|ref|XM_864887.2| PREDICTED: Bos taurus amylase, alpha 2A (pancreatic), transcript variant 2 (AMY2A), mRNA ATGAAGTTTTTTCTGTTGCTTTCAGCAATTGGGTTCTGCTGGGCTCAGTATGACCCACACGTCAAATCTG GACGGACCTCCATTGTCCATCTGTTTGAGTGGCGCTGGGTAGATATTGCTCTTGAATGTGAGCGATACTT AGCCCCCAAAGGATTTGGAGGGGTTCAGGTCTCCCCAC...

Created: 2010-06-11 | Last updated: 2010-06-11

Credits: User Prateek

Taverna 2
Uploader
1253?size=60x60 Gb Anja Le Blanc

Workflow Using HEK information to get DPAS data (1)

Thumb
Query HEK for all kinds of events and query DPAS for given instrument for data from event times.

Created: 2010-06-10 | Last updated: 2010-06-10

Credits: User Anja Le Blanc

RapidMiner
Uploader
1070?size=60x60 De Ingo Mierswa

Workflow Same Number of Examples per Class (Stratif... (1)

Thumb
This process can be used to sample examples from each class of the data set so that the number of examples per class is the same for all classes. The name of the label attribute is defined in the first "Set Macro" operator within the subprocess "Stratification". The result will be a stratified data set where each class is represented by the minimum number of examples for a single class minus 1 (due to calculation reasons in absolute sampling which is used here). The first two operators just...

Created: 2010-06-10

RapidMiner
Uploader
Avatar Sebastian Loh

Workflow Execute Program on Windows 7 (1)

Thumb
This simple process demonstrates how to execute a program on windows 7 even if the program path contains spaces. The process will start the Internet Explore if the path exists. Tags: Rapidminer, Execute Program, Windows 7

Created: 2010-06-09

Uploader
469?size=60x60 Gb Paolo
Show View Download Download

Blob Janus provenance graph (RDF)

Created: 2010-06-08 23:02:53 | Last updated: 2010-06-09 22:48:46

Credits: User Paolo

License: Creative Commons Attribution-Share Alike 3.0 Unported License

RDF instance file containing the entire provenance graph for once run of the PC1 mockup workflow. The RDF graph complies with the Janus ontology, which can be viewed here Caveat: implementation still under testing, file may still contain bugs  

File type: RDF data

Comments: 0 | Viewed: 87 times | Downloaded: 46 times

Tags:
RapidMiner
Uploader
1070?size=60x60 De Ingo Mierswa

Workflow Transform Attribute Names to lower Case (S... (1)

Thumb
This process uses a Script operator which transforms the attribute names of the input example set into lower case.

Created: 2010-06-06

RapidMiner
Uploader
1070?size=60x60 De Ingo Mierswa

Workflow Transform Attribute Names to Upper Case (S... (1)

Thumb
This process uses a Script operator which transforms the attribute names of the input example set into UPPER case.

Created: 2010-06-06

RapidMiner
Uploader
1069?size=60x60 De Sebastian land

Workflow Prepending common prefix to attributes (1)

Thumb
This process shows how one can add a common prefix to a subset of attributes. First a subset might be defined by the attribute set selection parameters of the rename by replacing operator. Then one can make use of the capturing group functionality of regular expressions to insert the original name into the replacement.

Created: 2010-06-04

RapidMiner
Uploader
1069?size=60x60 De Sebastian land

Workflow Combining nominal attributes with missing (1)

Thumb
This process will show how one can combine nominal values of attributes that contain missing values. A generate attribute operator is used and hence forbidden characters must first be replaced. After this, a condition in the generation ensures that no question mark (standing for missing value) will be shown in the result, if any of the two combined attributes is known.

Created: 2010-06-04

Creator
76?size=60x60 Gb Paul Dobson
Show View Download Download

Pack Mapping Metabolites for Metabolic Network Reconstruc...


Created: 2010-06-03 11:43:43 | Last updated: 2010-06-03 11:47:16

The process of metabolic network reconstructions typically begins with the task of collating existing information. For metabolites this poses a relatively straight forward set of cheminformatics problems. These problems include finding identical structures across sources, which is trivial, but also structures that differ due to idiosyncrasies of the sources or annotators. This includes charge differences, varying stereochemistry, tautomers, and so forth. Workflows in this pack allow sets of ...

6 items in this pack

Comments: 0 | Viewed: 100 times | Downloaded: 44 times

Tags:
Pipeline Pilot
Uploader
76?size=60x60 Gb Paul Dobson

Workflow M5 Charge Matching (1)

The process of metabolic network reconstructions typically begins with the task of collating existing information. For metabolites this poses a relatively straight forward set of cheminformatics problems. This workflow implements matching algorithm M5 which ionises molecules at pH 7 prior to matching, restores original structures.

Created: 2010-06-03

Credits: User Paul Dobson

Pipeline Pilot
Uploader
76?size=60x60 Gb Paul Dobson

Workflow M4 Tautomer Matching (1)

The process of metabolic network reconstructions typically begins with the task of collating existing information. For metabolites this poses a relatively straight forward set of cheminformatics problems. This workflow implements matching algorithm M4 which generates canonical tautomers prior to matching, matches, then restores original structures.

Created: 2010-06-03

Credits: User Paul Dobson

Pipeline Pilot
Uploader
76?size=60x60 Gb Paul Dobson

Workflow M3 Non-stereo Matching (1)

The process of metabolic network reconstructions typically begins with the task of collating existing information. For metabolites this poses a relatively straight forward set of cheminformatics problems. This workflow implements matching algorithm M3 which strips stereochemical information from molecules, performs exact matching, and restores stereochemistry.

Created: 2010-06-03

Credits: User Paul Dobson

Pipeline Pilot
Uploader
76?size=60x60 Gb Paul Dobson

Workflow M2 Similarity Matching (1)

The process of metabolic network reconstructions typically begins with the task of collating existing information. For metabolites this poses a relatively straight forward set of cheminformatics problems. This workflow implements matching algorithm M2 which reads molecules from two sources and produces clusters of highly similar molecules.

Created: 2010-06-03

Credits: User Paul Dobson

Pipeline Pilot
Uploader
76?size=60x60 Gb Paul Dobson

Workflow M1 Exact Matching (1)

The process of metabolic network reconstructions typically begins with the task of collating existing information. For metabolites this poses a relatively straight forward set of cheminformatics problems. This workflow implements matching algorithm M1 which matches fully specified molecules on the basis of their canonical representations.

Created: 2010-06-03

Credits: User Paul Dobson

Results per page:
Sort by:
Funded by: BioVeL, EPSRC, JISC, Microsoft

Affiliates: myGrid, Taverna, BioCatalogue
About | Privacy | Publications | Contact / Feedback | Mailing List
Icons: Silk icon set 1.3

Copyright © 2007 – 2018 The University of Manchester and University of Southampton