All content

Statistic_creation (1)

• Download

Created: 2010-06-15 | Last updated: 2010-06-15

Credits: Leidou

Statistic_CompositeCoactor (1)

• Download

Created: 2010-06-15 | Last updated: 2010-06-15

Credits: Leidou

Statistic (1)

• Download

Created: 2010-06-15 | Last updated: 2010-06-15

Credits: Leidou

two_station_RPlotter (1)

• Download

Created: 2010-06-15 | Last updated: 2010-06-15

Credits: Leidou

three_station_RPlotter (1)

• Download

Created: 2010-06-15 | Last updated: 2010-06-15

Credits: Leidou

one_station_SequencePlotter (1)

• Download

Created: 2010-06-15 | Last updated: 2010-06-15

Credits: Leidou

one_station_RPlotter (1)

• Download

Created: 2010-06-15 | Last updated: 2010-06-15

Credits: Leidou

View Download

comad comet demo workflow

Created: 2010-06-15 18:31:20 | Last updated: 2010-06-15 19:23:27

4 items in this pack

Comments: 0 | Viewed: 61 times | Downloaded: 30 times

View Download

Presentation: SKOS, Past, Present and Future

Created: 2010-06-15 11:18:56 | Last updated: 2010-07-17 08:22:00

3 items in this pack

Comments: 0 | Viewed: 38 times | Downloaded: 14 times

Function finding (1)

• Download

This process recursively generates new attributes by mathematically combining existing attributes with user selectable operators. At the end of each pass through the recursion attributes are thinned to prevent silicon smoke and unpleasantness. Sample input. P1    P2    A1    A2    RESULT 2       3      4      5      15 6     &...

Created: 2010-06-12 | Last updated: 2010-06-29

Nucleotide FASTA to PDB file. (1)

• Download

This workflow is designed to convert nucleotide fasta sequence to corresponding pdb file,which could be used for modelling. In this workflow nucleotide fasta sequence is given as input, eg. >gi|119889797|ref|XM_864887.2| PREDICTED: Bos taurus amylase, alpha 2A (pancreatic), transcript variant 2 (AMY2A), mRNA ATGAAGTTTTTTCTGTTGCTTTCAGCAATTGGGTTCTGCTGGGCTCAGTATGACCCACACGTCAAATCTG GACGGACCTCCATTGTCCATCTGTTTGAGTGGCGCTGGGTAGATATTGCTCTTGAATGTGAGCGATACTT AGCCCCCAAAGGATTTGGAGGGGTTCAGGTCTCCCCAC...

Created: 2010-06-11 | Last updated: 2010-06-11

Credits: Prateek

Using HEK information to get DPAS data (1)

• Download

Query HEK for all kinds of events and query DPAS for given instrument for data from event times.

Created: 2010-06-10 | Last updated: 2010-06-10

Credits: Anja Le Blanc

Same Number of Examples per Class (Stratif... (1)

• Download

This process can be used to sample examples from each class of the data set so that the number of examples per class is the same for all classes. The name of the label attribute is defined in the first "Set Macro" operator within the subprocess "Stratification". The result will be a stratified data set where each class is represented by the minimum number of examples for a single class minus 1 (due to calculation reasons in absolute sampling which is used here). The first two operators just...

Created: 2010-06-10

Execute Program on Windows 7 (1)

• Download

This simple process demonstrates how to execute a program on windows 7 even if the program path contains spaces. The process will start the Internet Explore if the path exists. Tags: Rapidminer, Execute Program, Windows 7

Created: 2010-06-09

View Download

Janus provenance graph (RDF)

Created: 2010-06-08 23:02:53 | Last updated: 2010-06-09 22:48:46

Credits: Paolo

License: Creative Commons Attribution-Share Alike 3.0 Unported License

File type: RDF data

Comments: 0 | Viewed: 87 times | Downloaded: 46 times

Transform Attribute Names to lower Case (S... (1)

• Download

This process uses a Script operator which transforms the attribute names of the input example set into lower case.

Created: 2010-06-06

Transform Attribute Names to Upper Case (S... (1)

• Download

This process uses a Script operator which transforms the attribute names of the input example set into UPPER case.

Created: 2010-06-06

Prepending common prefix to attributes (1)

• Download

This process shows how one can add a common prefix to a subset of attributes. First a subset might be defined by the attribute set selection parameters of the rename by replacing operator. Then one can make use of the capturing group functionality of regular expressions to insert the original name into the replacement.

Created: 2010-06-04

Combining nominal attributes with missing (1)

• Download

This process will show how one can combine nominal values of attributes that contain missing values. A generate attribute operator is used and hence forbidden characters must first be replaced. After this, a condition in the generation ensures that no question mark (standing for missing value) will be shown in the result, if any of the two combined attributes is known.

Created: 2010-06-04

View Download

Mapping Metabolites for Metabolic Network Reconstruc...

Created: 2010-06-03 11:43:43 | Last updated: 2010-06-03 11:47:16

6 items in this pack

Comments: 0 | Viewed: 100 times | Downloaded: 44 times

M5 Charge Matching (1)

• Download

Created: 2010-06-03

Credits: Paul Dobson

M4 Tautomer Matching (1)

• Download

Created: 2010-06-03

Credits: Paul Dobson

M3 Non-stereo Matching (1)

• Download

Created: 2010-06-03

Credits: Paul Dobson

M2 Similarity Matching (1)

• Download

Created: 2010-06-03

Credits: Paul Dobson

M1 Exact Matching (1)

• Download

Created: 2010-06-03

Credits: Paul Dobson

C1 Combined Workflow (1)

• Download

Created: 2010-06-03 | Last updated: 2010-06-03

Credits: Paul Dobson

Association rules as examples (1)

• Download

Uses Groovy scripting to lay out rules and their support metrics as examples.

Created: 2010-06-02

CamelCases (1)

• Download

this process splits up camelcases

Created: 2010-06-02

Creation of New Attribute Depending on Val... (1)

• Download

The process shows the usage of the operator "Generate Attributes" in combination with an "if - then - else" condition and nominal values. The values "value0" and "value1" are mapped to "T1", other values are mapped to "T2" for the new attribute.

Created: 2010-06-01

Linear Regression of Italian bookshops se... (1)

• Download

Someone could help me? Why the correlation between the actual value and the predictive value of the attribute "Quantita" is so low?

Created: 2010-05-28

View Download

Provenance Challenge 1 Workflow in Taverna

Created: 2010-05-28 07:21:42 | Last updated: 2010-06-21 16:15:46

4 items in this pack

Comments: 0 | Viewed: 67 times | Downloaded: 21 times

This Pack has no tags!

Provenance Challenge 1 workflow -- mockup ... (1)

• Download

simulates the image processing for the PC1 workflow using beanshell that simply track test strings an image is a pair (header, image) specified as a list of depth 1: [header,image] so each processor with image input takes an input list. Note that the processors are designed to operate on single images (except softmean that operates on a list of images), but because the initial input is a list of images, all are processed by implicit iteration.

Created: 2010-05-28

Credits: Paolo

Missing value count (1)

• Download

This workflow enables users to filter examples by the number of missing values they contains; it inserts the numeric attribute 'Missings' - representing, for each example, the count of attributes with missing values.

Created: 2010-05-27 | Last updated: 2010-07-13

Plot round results of a backward elimination (1)

• Download

This process will perform a backward elimination and logs all performance and deviation results of each round. This way, you can use the visualizations of rapidminer to asses the performance gain.

Created: 2010-05-26

Simple DPAS query (4)

• Download

queries dpas for each time priode and instrument

Created: 2010-05-26 | Last updated: 2011-12-15

Credits: Anja Le Blanc

Retrieve Instruments for event dates (2)

• Download

Queries the HELIO ICS web service and returns a list of instruments available for the time periodes in VOTable format

Created: 2010-05-26

Credits: Anja Le Blanc

A simple CQL query workflow in caGrid (1)

• Download

1. CQL is a language to query data from caGrid/caBIG services. This workflow is tested with Taverna 2.1.2 and the caGrid Workflow Suite downloadable from http://www.mcs.anl.gov/~wtan/t2/. 2.More information regarding CQL can be found from http://wiki.cagrid.org/display/dataservices. 3. Sample input (95) is provided in the workflow. It is to query all the hybridization data within a microarray experiment whose id is 95.

Created: 2010-05-24 | Last updated: 2010-05-25

Credits: Wei Tan

Query caArray data service and retrieving ... (2)

• Download

need to install Taverna 2 caGrid integration suite from http://www.mcs.anl.gov/~wtan/t2/ and get a cagrid Dorian account (see http://wiki.cagrid.org/display/caGrid13/Home)

Created: 2010-05-24 | Last updated: 2010-05-24

Credits: Wei Tan

simple HEC query (2)

• Download

HEC query for table 'goes_xray_flare'

Created: 2010-05-21 | Last updated: 2010-08-04

Credits: Anja Le Blanc

View Download

ProStack Screencast: Segmentation of Images of Gene ...

Created: 2010-05-20 19:48:40

Credits: Konstantin Kozlov

License: Creative Commons Attribution-Noncommercial-No Derivative Works 3.0 Unported License

File type: AVI video

Comments: 0 | Viewed: 64 times | Downloaded: 26 times

Warp2D - 2D Time Alignment Workflow (3)

• Download

2D Time Alignment We describe a new time alignment method that takes advantage of both dimensions of LC-MS data to resolve ambiguities in peak matching while remaining computationally efficient. This approach, Warp2D, combines peak extraction with a two-dimensional correlation function to provide a reliable alignment scoring function that is insensitive to spurious peaks and background noise. One-dimensional alignment methods are often based on the total-ion-current eluti...

Created: 2010-05-20 | Last updated: 2010-11-22

Credits: Ishtiaq AHMAD

Exclude a Attribute/Variable (1)

• Download

This simple process demonstrates how to exclude a attribute or set of attributes from an example set/data set. In particular the first "Select Attributes" filter excludes the Outlook attribute. The second filter excludes subset {Outlook, Humidity}.

Created: 2010-05-20

Filter Wrong Predicted/Classified Samples (1)

• Download

This process demonstrates how to filter validation samples which are predicted incorrectly. Thee key operator is "Filter Examples" that is set up to "wrong_predictions"

Created: 2010-05-19 | Last updated: 2010-06-08

Apply Same Preprocessing to Learning and V... (1)

• Download

This process demonstrates how to apply the same prepossessing work flow to learning data and test/validation data. Due to overview reasons the preprocessing is hidden in a Preprocessing subprocess. To perform the same preprocessing work flow on the learning and testing data, both are collected to a Collection of Data. Then the "Loop Collection" operator loops over each collection. The actual preprocessing is done inside the "Loop Collection" operator. In the example only a "Rename" is done...

Created: 2010-05-19

Write/Store Correlation Matrix to an Excel... (1)

• Download

This process demonstrates how to write/store/export the correlation matrix of the "Correlation Matrix" operator to an Excel file. One need to generate a Report with the "Generate Report" operator and export the Report to an Excel file.

Created: 2010-05-19

OpenTox Handle Task (8)

• Download

Waits for a task to be finished and returns resulting URI

Created: 2010-05-18

Discard Attribute with More than x% Missin... (1)

• Download

This process loops over all attributes and calculates the fraction of missings for each attribute. If this fration is larger than the fraction defined in the first "Set Macro" operator (macro: max_unknown), the attribute will be removed from the example set.

Created: 2010-05-15

Convert Nominal to Binominal to Numerical (1)

• Download

This is a standard preprocessing subprocess taking nominal (categorical) attributes and introduces binominal dummy attributes before those are transformed to numerical which can be then used by learning schemes like SVM or Logistic Regression.

Created: 2010-05-15

Pivoting (1)

• Download

This process shows the basics of Pivoting. A data set with three columns is loaded and partially generated. Afterwards, the data is rotated and missings are replaced by zero.

Created: 2010-05-15

Evaluating Multiple Models with Looped X-V... (1)

• Download

This process shows how multiple different models can be evaluated with cross validation runs. This allows for the comparison of, for example, three prediction model types (e.g., ANN, SVM and DT) all at once under a x-fold cross validation. Having said that, the process actually performs the same cross validation several times using each time a different modeling scheme. It makes use of loops, collections, subprocess selection and macros and is therefore also an interesting showcase for more ...

Created: 2010-05-15