All content

Nucleotide FASTA to PDB file. (1)

• Download

This workflow is designed to convert nucleotide fasta sequence to corresponding pdb file,which could be used for modelling. In this workflow nucleotide fasta sequence is given as input, eg. >gi|119889797|ref|XM_864887.2| PREDICTED: Bos taurus amylase, alpha 2A (pancreatic), transcript variant 2 (AMY2A), mRNA ATGAAGTTTTTTCTGTTGCTTTCAGCAATTGGGTTCTGCTGGGCTCAGTATGACCCACACGTCAAATCTG GACGGACCTCCATTGTCCATCTGTTTGAGTGGCGCTGGGTAGATATTGCTCTTGAATGTGAGCGATACTT AGCCCCCAAAGGATTTGGAGGGGTTCAGGTCTCCCCAC...

Created: 2010-06-11 | Last updated: 2010-06-11

Credits: Prateek

Using HEK information to get DPAS data (1)

• Download

Query HEK for all kinds of events and query DPAS for given instrument for data from event times.

Created: 2010-06-10 | Last updated: 2010-06-10

Credits: Anja Le Blanc

Same Number of Examples per Class (Stratif... (1)

• Download

This process can be used to sample examples from each class of the data set so that the number of examples per class is the same for all classes. The name of the label attribute is defined in the first "Set Macro" operator within the subprocess "Stratification". The result will be a stratified data set where each class is represented by the minimum number of examples for a single class minus 1 (due to calculation reasons in absolute sampling which is used here). The first two operators just...

Created: 2010-06-10

Execute Program on Windows 7 (1)

• Download

This simple process demonstrates how to execute a program on windows 7 even if the program path contains spaces. The process will start the Internet Explore if the path exists. Tags: Rapidminer, Execute Program, Windows 7

Created: 2010-06-09

View Download

Janus provenance graph (RDF)

Created: 2010-06-08 23:02:53 | Last updated: 2010-06-09 22:48:46

Credits: Paolo

License: Creative Commons Attribution-Share Alike 3.0 Unported License

File type: RDF data

Comments: 0 | Viewed: 87 times | Downloaded: 46 times

Transform Attribute Names to lower Case (S... (1)

• Download

This process uses a Script operator which transforms the attribute names of the input example set into lower case.

Created: 2010-06-06

Transform Attribute Names to Upper Case (S... (1)

• Download

This process uses a Script operator which transforms the attribute names of the input example set into UPPER case.

Created: 2010-06-06

Prepending common prefix to attributes (1)

• Download

This process shows how one can add a common prefix to a subset of attributes. First a subset might be defined by the attribute set selection parameters of the rename by replacing operator. Then one can make use of the capturing group functionality of regular expressions to insert the original name into the replacement.

Created: 2010-06-04

Combining nominal attributes with missing (1)

• Download

This process will show how one can combine nominal values of attributes that contain missing values. A generate attribute operator is used and hence forbidden characters must first be replaced. After this, a condition in the generation ensures that no question mark (standing for missing value) will be shown in the result, if any of the two combined attributes is known.

Created: 2010-06-04

View Download

Mapping Metabolites for Metabolic Network Reconstruc...

Created: 2010-06-03 11:43:43 | Last updated: 2010-06-03 11:47:16

6 items in this pack

Comments: 0 | Viewed: 100 times | Downloaded: 44 times