Workflows

Demonstration of configurable iteration (1)

• Download

This workflow shows the use of the iteration strategy editor to ensure that only relevant combinations of inputs are used during an implicit iteration.

Created: 2010-07-04 | Last updated: 2010-07-04

Credits: Tomoinn

BioMoby tutorial workflow (1)

• Download

A workflow from part of the BioMoby tutorial

Created: 2010-07-04 | Last updated: 2010-07-04

Credits: EdwardKawas

BiomartAndEMBOSSAnalysis (1)

• Download

Using Biomart and EMBOSS soaplab services, This workflow retrieves a number of sequences from 3 species: mouse, human, rat; align them, and returns a plot of the alignment result. Corresponding sequence ids are also returned.

Created: 2010-07-04 | Last updated: 2010-07-04

Credits: Alan Williams

A workflow version of the EMBOSS tutorial (1)

• Download

Designed to show the use of EMBOSS based Soaplab services from Taverna, this workflow has no inputs as all initial values are specified as string constants. A sequence set is fetched using the seqret tool, then simultaneously scanned for predicted transmembrane regions and subjected to a multiple alignment using emma. This alignment is then plotted to a set of PNG images and also used to build a profile using the prophecy and prophet tools.

Created: 2010-07-04 | Last updated: 2010-07-04

Credits: Tomoinn

Extracting data from VOTable format by usi... (1)

• Download

Input VOTable and 'name' of a Output corrosponding data of that field in an arrayInput VOTable and 'name' of a Field

Created: 2010-07-01 | Last updated: 2010-07-01

Credits: Anja Le Blanc Donal Fellows

Holograph Reduced Representation (1)

• Download

After Kanerwa

Created: 2010-06-29

Workflow for Automated Comparative Protein... (2)

• Download

This workflow performs "parallel" generic protein sequence analysis. In order to do that a list of known protein identifiers chosen by the biologist enters into the software to perform different multiple sequence alignments and finally phylogenetic analysis.

Created: 2010-06-29 | Last updated: 2010-08-31

Credits: Achille Zappa

Attributions: EBI_ClustalW_alignment_tree

Macro Propagation into Subprocesses and Ex... (1)

• Download

<p> This small process demonstrates how to propagate macros into a subprocess or Execute Process operator </p> <p> When macros are set once, they are available in subprocesses imediatly (see Generate Attributes in the seconde Subprocess operator) </p> <p> If someone wants to propagate a macro into a Excecute Process operator one need to edit the "macros" parameter in the Parameters list of the Execute Process operator. </p> Tags: Subprocess, Execute Proc...

Created: 2010-06-25

Resolve an InChIKey on ChemSpider (1)

• Download

 Resolves an InChIKey on ChemSpider and opens the search results in a molecules table.

Created: 2010-06-23 | Last updated: 2010-06-23

Credits: Egon Willighagen

Downloads all Bioclipse Scripting Language... (1)

• Download

 Downloads all Bioclipse Scripting Language scripts uploaded to MyExperiment into the Bioclipse workspace, and opens them in JavaScript editors.

Created: 2010-06-23 | Last updated: 2010-06-23

Credits: Egon Willighagen

Syntetic population mapper (3)

• Download

This workflow creates individual-level population from census data and then joins with the BHPS (British Household Panel Survey) and reaggregates. In the last stage it maps the chosen BHPS field.

Created: 2010-06-23 | Last updated: 2010-12-09

Credits: Alex Nenadic

Pre process data per group using recall re... (1)

• Download

This process takes as input a dataset with different groups. For each group it discretises attributes into High, Medium, Low. This creates a group invariant representation.

Created: 2010-06-23 | Last updated: 2010-06-23

Discretization into Deviation Interval aro... (1)

• Download

This process shows how numerical attributes can be discretized into intervals based on the standard deviation for each attribute around their mean values.

Created: 2010-06-22 | Last updated: 2010-06-22

Finding all Examples that have duplicate v... (1)

• Download

This process will retrieve all examples, who have identical values in a specific attribute. For testing, the following data can be writen into the file, that will be read by the Read CSV operator: CID,Value 3596,X 4054,X 4054,X 3000,S 3000,T 3000,U 32135,S The target of this process is to return the two examples having the same value in the CID column. To achieve this, first a real id is generated by the generate id. After this, we have to find all duplicates: For this we first remove dupl...

Created: 2010-06-18

Optimizing Discretization (1)

• Download

This process generates a decision tree on the Iris data set. Before the decision tree is generated, the input attributes are discretised so we only work on nominal attributes. We use a combination of "Select Subprocess" and "Optimize Parameters" to select the best out of five different discretizazion methods independently for each of the attributes. The process shows, that the resulting accuracy heavily depends on the choice of the method. It varies between 64% and 94%.

Created: 2010-06-18 | Last updated: 2010-06-18

Phylogenetic Study Using the Bio Extract S... (2)

• Download

This workflow, created using the BioExtract Server, contains a nucleotide query (using the NCBI Core Nucleotide Database), Blastn (against the Homo sapiens genome), Blastn (against the Mus musculus genome), the Format Conversion tool, the Fetch Translator Tool, and ClustalW. This workflow was created following the analytical steps described in the journal article "Resolution among major placental mammal interordinal relationships with genome data imply that speciation influenced the...

Created: 2010-06-17 | Last updated: 2010-07-19

Credits: Kendra Giesey BioExtract Server for Genomics

SDS-Page Gel (1)

• Download

Created: 2010-06-17 | Last updated: 2010-06-17

Credits: http://thebluerhino.myopenid.com/

Unbiasing procedure (1)

• Download

It is a workflow for description of our unbiasing procedure that is used in LiquidPub project,  "Peer Review and Reviewer Behavior" branch. The procedure is used  for conducting experiments on conference data.

Created: 2010-06-16 | Last updated: 2010-06-16

Credits: Katsiaryna Mirylenka

Preprocessing nominal data for frequent it... (1)

• Download

This process will first create artificial data that can be compared to usual data loaded for frequent item set mining: Nominal Data with a true and false value, but differently mapped to internal indices. For ItemSet Mining these must be preprocessed to avoid problems: First they have to be transformed to Binominal Attributes, then it has to be defined, which is the positive and the negative value.

Created: 2010-06-16 | Last updated: 2010-06-16

PI_Calculation (1)

• Download

Created: 2010-06-15 | Last updated: 2010-06-15

Credits: Leidou

BioMoby_PhylogeneticTree (1)

• Download

Created: 2010-06-15 | Last updated: 2010-06-15

Credits: Leidou

BioMoby_Blast (1)

• Download

Created: 2010-06-15 | Last updated: 2010-06-15

Credits: Leidou

Statistic_XmlInputFormat (1)

• Download

Created: 2010-06-15 | Last updated: 2010-06-15

Credits: Leidou

Statistic_UserDefinedType (1)

• Download

Created: 2010-06-15 | Last updated: 2010-06-15

Credits: Leidou

Statistic_TypeAlias (1)

• Download

Created: 2010-06-15 | Last updated: 2010-06-15

Credits: Leidou

Statistic_portReference (1)

• Download

Created: 2010-06-15 | Last updated: 2010-06-15

Credits: Leidou

Statistic_filter (1)

• Download

Created: 2010-06-15 | Last updated: 2010-06-15

Credits: Leidou

Statistic_creation (1)

• Download

Created: 2010-06-15 | Last updated: 2010-06-15

Credits: Leidou

Statistic_CompositeCoactor (1)

• Download

Created: 2010-06-15 | Last updated: 2010-06-15

Credits: Leidou

Statistic (1)

• Download

Created: 2010-06-15 | Last updated: 2010-06-15

Credits: Leidou

two_station_RPlotter (1)

• Download

Created: 2010-06-15 | Last updated: 2010-06-15

Credits: Leidou

three_station_RPlotter (1)

• Download

Created: 2010-06-15 | Last updated: 2010-06-15

Credits: Leidou

one_station_SequencePlotter (1)

• Download

Created: 2010-06-15 | Last updated: 2010-06-15

Credits: Leidou

one_station_RPlotter (1)

• Download

Created: 2010-06-15 | Last updated: 2010-06-15

Credits: Leidou

Function finding (1)

• Download

This process recursively generates new attributes by mathematically combining existing attributes with user selectable operators. At the end of each pass through the recursion attributes are thinned to prevent silicon smoke and unpleasantness. Sample input. P1    P2    A1    A2    RESULT 2       3      4      5      15 6     &...

Created: 2010-06-12 | Last updated: 2010-06-29

Nucleotide FASTA to PDB file. (1)

• Download

This workflow is designed to convert nucleotide fasta sequence to corresponding pdb file,which could be used for modelling. In this workflow nucleotide fasta sequence is given as input, eg. >gi|119889797|ref|XM_864887.2| PREDICTED: Bos taurus amylase, alpha 2A (pancreatic), transcript variant 2 (AMY2A), mRNA ATGAAGTTTTTTCTGTTGCTTTCAGCAATTGGGTTCTGCTGGGCTCAGTATGACCCACACGTCAAATCTG GACGGACCTCCATTGTCCATCTGTTTGAGTGGCGCTGGGTAGATATTGCTCTTGAATGTGAGCGATACTT AGCCCCCAAAGGATTTGGAGGGGTTCAGGTCTCCCCAC...

Created: 2010-06-11 | Last updated: 2010-06-11

Credits: Prateek

Using HEK information to get DPAS data (1)

• Download

Query HEK for all kinds of events and query DPAS for given instrument for data from event times.

Created: 2010-06-10 | Last updated: 2010-06-10

Credits: Anja Le Blanc

Same Number of Examples per Class (Stratif... (1)

• Download

This process can be used to sample examples from each class of the data set so that the number of examples per class is the same for all classes. The name of the label attribute is defined in the first "Set Macro" operator within the subprocess "Stratification". The result will be a stratified data set where each class is represented by the minimum number of examples for a single class minus 1 (due to calculation reasons in absolute sampling which is used here). The first two operators just...

Created: 2010-06-10

Execute Program on Windows 7 (1)

• Download

This simple process demonstrates how to execute a program on windows 7 even if the program path contains spaces. The process will start the Internet Explore if the path exists. Tags: Rapidminer, Execute Program, Windows 7

Created: 2010-06-09

Transform Attribute Names to lower Case (S... (1)

• Download

This process uses a Script operator which transforms the attribute names of the input example set into lower case.

Created: 2010-06-06

Transform Attribute Names to Upper Case (S... (1)

• Download

This process uses a Script operator which transforms the attribute names of the input example set into UPPER case.

Created: 2010-06-06

Prepending common prefix to attributes (1)

• Download

This process shows how one can add a common prefix to a subset of attributes. First a subset might be defined by the attribute set selection parameters of the rename by replacing operator. Then one can make use of the capturing group functionality of regular expressions to insert the original name into the replacement.

Created: 2010-06-04

Combining nominal attributes with missing (1)

• Download

This process will show how one can combine nominal values of attributes that contain missing values. A generate attribute operator is used and hence forbidden characters must first be replaced. After this, a condition in the generation ensures that no question mark (standing for missing value) will be shown in the result, if any of the two combined attributes is known.

Created: 2010-06-04

M5 Charge Matching (1)

• Download

Created: 2010-06-03

Credits: Paul Dobson

M4 Tautomer Matching (1)

• Download

Created: 2010-06-03

Credits: Paul Dobson

M3 Non-stereo Matching (1)

• Download

Created: 2010-06-03

Credits: Paul Dobson

M2 Similarity Matching (1)

• Download

Created: 2010-06-03

Credits: Paul Dobson

M1 Exact Matching (1)

• Download

Created: 2010-06-03

Credits: Paul Dobson

C1 Combined Workflow (1)

• Download

Created: 2010-06-03 | Last updated: 2010-06-03

Credits: Paul Dobson

Association rules as examples (1)

• Download

Uses Groovy scripting to lay out rules and their support metrics as examples.

Created: 2010-06-02

CamelCases (1)

• Download

this process splits up camelcases

Created: 2010-06-02

Creation of New Attribute Depending on Val... (1)

• Download

The process shows the usage of the operator "Generate Attributes" in combination with an "if - then - else" condition and nominal values. The values "value0" and "value1" are mapped to "T1", other values are mapped to "T2" for the new attribute.

Created: 2010-06-01

Linear Regression of Italian bookshops se... (1)

• Download

Someone could help me? Why the correlation between the actual value and the predictive value of the attribute "Quantita" is so low?

Created: 2010-05-28

Provenance Challenge 1 workflow -- mockup ... (1)

• Download

simulates the image processing for the PC1 workflow using beanshell that simply track test strings an image is a pair (header, image) specified as a list of depth 1: [header,image] so each processor with image input takes an input list. Note that the processors are designed to operate on single images (except softmean that operates on a list of images), but because the initial input is a list of images, all are processed by implicit iteration.

Created: 2010-05-28

Credits: Paolo

Missing value count (1)

• Download

This workflow enables users to filter examples by the number of missing values they contains; it inserts the numeric attribute 'Missings' - representing, for each example, the count of attributes with missing values.

Created: 2010-05-27 | Last updated: 2010-07-13

Plot round results of a backward elimination (1)

• Download

This process will perform a backward elimination and logs all performance and deviation results of each round. This way, you can use the visualizations of rapidminer to asses the performance gain.

Created: 2010-05-26

Simple DPAS query (4)

• Download

queries dpas for each time priode and instrument

Created: 2010-05-26 | Last updated: 2011-12-15

Credits: Anja Le Blanc

Retrieve Instruments for event dates (2)

• Download

Queries the HELIO ICS web service and returns a list of instruments available for the time periodes in VOTable format

Created: 2010-05-26

Credits: Anja Le Blanc

A simple CQL query workflow in caGrid (1)

• Download

1. CQL is a language to query data from caGrid/caBIG services. This workflow is tested with Taverna 2.1.2 and the caGrid Workflow Suite downloadable from http://www.mcs.anl.gov/~wtan/t2/. 2.More information regarding CQL can be found from http://wiki.cagrid.org/display/dataservices. 3. Sample input (95) is provided in the workflow. It is to query all the hybridization data within a microarray experiment whose id is 95.

Created: 2010-05-24 | Last updated: 2010-05-25

Credits: Wei Tan

Query caArray data service and retrieving ... (2)

• Download

need to install Taverna 2 caGrid integration suite from http://www.mcs.anl.gov/~wtan/t2/ and get a cagrid Dorian account (see http://wiki.cagrid.org/display/caGrid13/Home)

Created: 2010-05-24 | Last updated: 2010-05-24

Credits: Wei Tan

simple HEC query (2)

• Download

HEC query for table 'goes_xray_flare'

Created: 2010-05-21 | Last updated: 2010-08-04

Credits: Anja Le Blanc

Warp2D - 2D Time Alignment Workflow (3)

• Download

2D Time Alignment We describe a new time alignment method that takes advantage of both dimensions of LC-MS data to resolve ambiguities in peak matching while remaining computationally efficient. This approach, Warp2D, combines peak extraction with a two-dimensional correlation function to provide a reliable alignment scoring function that is insensitive to spurious peaks and background noise. One-dimensional alignment methods are often based on the total-ion-current eluti...

Created: 2010-05-20 | Last updated: 2010-11-22

Credits: Ishtiaq AHMAD

Exclude a Attribute/Variable (1)

• Download

This simple process demonstrates how to exclude a attribute or set of attributes from an example set/data set. In particular the first "Select Attributes" filter excludes the Outlook attribute. The second filter excludes subset {Outlook, Humidity}.

Created: 2010-05-20

Filter Wrong Predicted/Classified Samples (1)

• Download

This process demonstrates how to filter validation samples which are predicted incorrectly. Thee key operator is "Filter Examples" that is set up to "wrong_predictions"

Created: 2010-05-19 | Last updated: 2010-06-08

Apply Same Preprocessing to Learning and V... (1)

• Download

This process demonstrates how to apply the same prepossessing work flow to learning data and test/validation data. Due to overview reasons the preprocessing is hidden in a Preprocessing subprocess. To perform the same preprocessing work flow on the learning and testing data, both are collected to a Collection of Data. Then the "Loop Collection" operator loops over each collection. The actual preprocessing is done inside the "Loop Collection" operator. In the example only a "Rename" is done...

Created: 2010-05-19

Write/Store Correlation Matrix to an Excel... (1)

• Download

This process demonstrates how to write/store/export the correlation matrix of the "Correlation Matrix" operator to an Excel file. One need to generate a Report with the "Generate Report" operator and export the Report to an Excel file.

Created: 2010-05-19

OpenTox Handle Task (8)

• Download

Waits for a task to be finished and returns resulting URI

Created: 2010-05-18

Discard Attribute with More than x% Missin... (1)

• Download

This process loops over all attributes and calculates the fraction of missings for each attribute. If this fration is larger than the fraction defined in the first "Set Macro" operator (macro: max_unknown), the attribute will be removed from the example set.

Created: 2010-05-15

Convert Nominal to Binominal to Numerical (1)

• Download

This is a standard preprocessing subprocess taking nominal (categorical) attributes and introduces binominal dummy attributes before those are transformed to numerical which can be then used by learning schemes like SVM or Logistic Regression.

Created: 2010-05-15

Pivoting (1)

• Download

This process shows the basics of Pivoting. A data set with three columns is loaded and partially generated. Afterwards, the data is rotated and missings are replaced by zero.

Created: 2010-05-15

Evaluating Multiple Models with Looped X-V... (1)

• Download

This process shows how multiple different models can be evaluated with cross validation runs. This allows for the comparison of, for example, three prediction model types (e.g., ANN, SVM and DT) all at once under a x-fold cross validation. Having said that, the process actually performs the same cross validation several times using each time a different modeling scheme. It makes use of loops, collections, subprocess selection and macros and is therefore also an interesting showcase for more ...

Created: 2010-05-15

Setting an attribute value in a specific E... (1)

• Download

This process will first generate an artificial dataset and tag it with ids. Then a Filter Examples Operator is used to get a dataset with exactly one example identified by it's id. Then a value is set in this example. Since the change in the data will be reflected in all views of the example set, a simply copy is passed by to the process' output. If you take a look at the attributes of the example with id 5, you will find the 12 there.

Created: 2010-05-14

Correct Attribute Type to Binominal (1)

• Download

This process will first generate some artificial data to show a commonly known problem: Some attributes have only two values, but are not correctly stored as Binominal, instead RapidMiner recognizes them as nominal. In order to use them for some special operators, we have to change this to binominal. We can achieve this by using the Nominal to Binominal operator with the the parameter transform_binominals switched off. Please take a look at the data before and after the Nominal to Binominal o...

Created: 2010-05-14

EntrezGeneId_to_GOFunction (1)

• Download

The workflow takes a list of Entrez gene ids and returns the corresponding GO function definitions. Example value: 1306 486 4712 108 9912 7639 23786

Created: 2010-05-13 | Last updated: 2010-05-13

Credits: Franck Tanoh

BLAST workflow (1)

• Download

You can get three BLAST results against DDBJ, swiss-prot and PDB by using accession number of DDBJ.

Created: 2010-05-13 | Last updated: 2010-05-13

Credits: wabi

BLAST-ClustalW workflow (1)

• Download

Execute blastn against DDBJ database with a given DNA sequence and compare the alignment regions of high similar sequences by using ClustalW.

Created: 2010-05-13 | Last updated: 2010-05-13

Credits: wabi

Virus genome extraction workflow (1)

• Download

Retrieve genome entries which agree with the following conditions regarding the Definition item of entries from both VRL and PHG division in DDBJ. Includes "complete sequence" or includes "segment" and "complete sequence" Not include "TPA:" and "nearly complete"

Created: 2010-05-13 | Last updated: 2010-05-13

Credits: wabi

Homology workflow (1)

• Download

There are many kinds of DNA data derived from many species in DDBJ. It makes possible to carry out the comparative study of genes of multiple species. The workflow provides a list of species and their genes that are similar to a human gene in response to a name of the human gene.

Created: 2010-05-12 | Last updated: 2010-05-12

Credits: wabi

Federated query using DCQL and credential ... (2)

• Download

CDS_Activity issues an EPR of the delegated credential. FQP uses this EPR to fetch the actual delegated credential from CDS and uses it to invoke multiple data services (the query activity) on behalf of the invoker. CDS_Activity issues an EPR of the delegated credential. FQP uses this EPR to fetch the actual delegated credential from CDS and uses it to invoke multiple data services (the query activity) on behalf of the invoker. Need to install Taverna 2 caGrid integration suite from http://ww...

Created: 2010-05-11 | Last updated: 2010-11-05

Credits: Wei Tan

OpenTox Get Datasets (3)

• Download

Gets a list of available data set URIs

Created: 2010-05-11

OpenTox Get Algorithms on TUM server (6)

• Download

Get URIs of all available algorithms on TUM server

Created: 2010-05-11 | Last updated: 2011-05-11

OpenTox Apply Model On Dataset (3)

• Download

Apply a model to predict a dataset

Created: 2010-05-11 | Last updated: 2010-05-11

OpenTox Apply Algorithm (7)

• Download

Apply an OpenTox algorithm

Created: 2010-05-11 | Last updated: 2011-05-11

Defining positive class with Remap Binominal (1)

• Download

This process shows how one can use the Remap Binominal operator to define which label value is treated as the positive class.

Created: 2010-05-11

iceLogo (1)

• Download

This example workflow creates an iceLogo

Created: 2010-05-07 | Last updated: 2010-05-07

Credits: N. Colaert

Weighted Score Tables (1)

• Download

This process calculates a weighted score as known from SAP BW. The first operator generates data similar to that used in the links you provided. The next operator (Discretize) defines the different age groups. The next three operators map each age group to the value used for scoring. The last operator finally calculates the score and adds it as a new column to your data set.

Created: 2010-05-05

Generating Example Weights depending on label (1)

• Download

This process uses a Generate Attribute operator for assigning new weights to examples. It uses the if condition of this operator to distinguish between labels. This can be especially useful if you have a strong bias in your class frequency, which can harm learning. Please note that you must use a learning algorithm that supports weighted examples.

Created: 2010-05-03

Uniprot Protein Visualization (1)

• Download

Jmol 3D visualization of a protein structure.

Created: 2010-05-01 | Last updated: 2010-05-01

Genes encoded by KEGG pathway (1)

• Download

Takes a KEGG pathway (e.g. hsa00232), finds the proteins that those genes code for and returns the sequences of those proteins.

Created: 2010-04-30 | Last updated: 2010-05-01

Get KEGG gene descriptions and pathways (1)

• Download

This workflow takes a list of KEGG gene identifiers and supplies descriptions associated to said genes + pathways including all genes and the descriptions associated to said pathways. The list_to_string local beanshell scripts merely transform a given list into a string of unique not-null elements separated by new lines (for batch btit use). Note that the input is a real taverna list : multiple values must be declared as multiple values instead of a single string value with distinct identif...

Created: 2010-04-30 | Last updated: 2010-04-30

Credits: Nadia Cerezo Paul Fisher

Attributions: Get Kegg Gene information

Transaction Analysis Demo from RM 5 Intro Day (1)

• Download

This is the demo process presented at the RapidMiner 5 Intro Day. It combines customer segmentation with direct mailing. It loads some transaction data, aggregates and pivotes the data so it can be used by a clustering to perform a customer segmentation. Then, additional data is joined with the clustered data. First, response/no-response data is joined, and them some additional information about the users is added. Finally, customers are classified into response/no-response classes. The dat...

Created: 2010-04-30 | Last updated: 2010-05-05

Stacking (1)

• Download

RapidMiner supports Meta Learning by embedding one or several basic learners as children into a parent meta learning operator. Here, we use a three base learners inside the stacking operator: decision tree induction, linear regression, and a nearest neighbours classifier. Finally, a Naive Bayes learner is used as a stacking learner which uses the predictions of the preceeding three learners to make a combined prediction.

Created: 2010-04-29

Crossvalidation with SVM (1)

• Download

Performs a crossvalidation on a given data set with nominal label, using a Support Vector Machine as a learning algorithm. Inside the cross validation, the first subprocess generates an SVM model, and the second subprocess evaluates it. applying it on a so-far unused subset of the data and counting the misclassifications.

Created: 2010-04-29

Looping over Examples for doing de-aggrega... (1)

• Download

This process is based on (artificially generated) data that looks like it has been aggregated before. The integer attribute Qty specifies the quantity of the given item that is represented by the rest of the example. The process now loops over every example and performs on each example another loop, that will append the current example to a new example set. This example set has been created as empty copy of the original example set, so that the attributes are equally. To get access to and rem...

Created: 2010-04-29

ChEBI mashup from searched string (1)

• Download

A demo showing hoe to use SOAP services from Bio2RDF ChEBI SPARQL endpoint.A demo showing hoe to use SOAP services from Bio2RDF ChEBI SPARQL endpoint. First a full text search query is done, then we do a reverse link query to get all the related topic. Finally with a describe queries we obtain the complete graph of each topic. The ntriples result is a mashup of what is known about this searched topic form ChEBI. This graph can then be loaded in a triplestore for further exploration.

Created: 2010-04-29

Credits: Francois Belleau

Get survey data from SurveyMapper (2)

• Download

Extracting public data (such as public surveys and their questions) from SurveyMapper. SurveyMapper (http://www.surveymapper.com/) a free real-time geographic survey and polling tool from the nice people at the Centre for Advanced Spatial Analysis, University College London.

Created: 2010-04-21 | Last updated: 2010-06-18

Credits: Alex Nenadic

Census data service (1)

• Download

Census data services, invoked with a fixed SQL query

Created: 2010-04-21 | Last updated: 2010-04-21

Credits: Alex Nenadic

Census data and PRM services integration (1)

• Download

This workflow combines services that provide census data with PRM (Population Reconstruction Model) services.

Created: 2010-04-21 | Last updated: 2010-04-21

Credits: Alex Nenadic

retrieve data for all instruments for even... (1)

• Download

This workflow uses the HEC to retrieve events for a time spane given by the user from a HEC table given by the user as well. It uses all instruments available in the DPAS to retrieve data for the events Output: XML as returned by the DPASThis workflow uses the HEC to retrieve events for a time spane given by the user from a HEC table given by the user as well. It uses all instruments available in the DPAS to retrieve data for the events; empty results are filtered out, the data is combind wi...

Created: 2010-04-21

Credits: Anja Le Blanc

Attributions: DPAS general query HEC standard query Retrieve all data for all instruments for a given periode of time

DPAS general query with sorted field (1)

• Download

same as DPAS general query. Calling the DPAS sortedQuery web service. additional input: partialSorting input boolean true or false false all result entries are sorted by start measurementTime true each request is sorted by measurement time; no overall time order, but queries stay in the order they there asked.

Created: 2010-04-19 | Last updated: 2010-04-19

Credits: Anja Le Blanc