myExperiment - Workflows

Taverna 2

Uploader

Paolo

Provenance Challenge 1 workflow -- mockup ... (1)

Download

simulates the image processing for the PC1 workflow using beanshell that simply track test strings an image is a pair (header, image) specified as a list of depth 1: [header,image] so each processor with image input takes an input list. Note that the processors are designed to operate on single images (except softmean that operates on a list of images), but because the initial input is a list of images, all are processed by implicit iteration.

Created: 2010-05-28

Credits: Paolo

Taverna 2

Uploader

Anja Le Blanc

Using HEK information to get DPAS data (1)

Download

Query HEK for all kinds of events and query DPAS for given instrument for data from event times.

Created: 2010-06-10 | Last updated: 2010-06-10

Credits: Anja Le Blanc

Taverna 2

Uploader

Prateek

Nucleotide FASTA to PDB file. (1)

Download

This workflow is designed to convert nucleotide fasta sequence to corresponding pdb file,which could be used for modelling. In this workflow nucleotide fasta sequence is given as input, eg. >gi|119889797|ref|XM_864887.2| PREDICTED: Bos taurus amylase, alpha 2A (pancreatic), transcript variant 2 (AMY2A), mRNA ATGAAGTTTTTTCTGTTGCTTTCAGCAATTGGGTTCTGCTGGGCTCAGTATGACCCACACGTCAAATCTG GACGGACCTCCATTGTCCATCTGTTTGAGTGGCGCTGGGTAGATATTGCTCTTGAATGTGAGCGATACTT AGCCCCCAAAGGATTTGGAGGGGTTCAGGTCTCCCCAC...

Created: 2010-06-11 | Last updated: 2010-06-11

Credits: Prateek

Taverna 2

Uploader

Paolo

Provenance Challenge 1 workflow part A -- ... (1)

Download

No description

Created: 2010-06-21 | Last updated: 2010-06-21

Credits: Paolo

Taverna 2

Uploader

Paolo

Provenance Challenge 1 workflow part B -- ... (1)

Download

No description

Created: 2010-06-21 | Last updated: 2010-06-21

Credits: Paolo

Taverna 2

Uploader

Alex Nenadic

Syntetic population mapper (3)

Download

This workflow creates individual-level population from census data and then joins with the BHPS (British Household Panel Survey) and reaggregates. In the last stage it maps the chosen BHPS field.

Created: 2010-06-23 | Last updated: 2010-12-09

Credits: Alex Nenadic

Taverna 2

Uploader

Achille Zappa

Workflow for Automated Comparative Protein... (2)

Download

This workflow performs "parallel" generic protein sequence analysis. In order to do that a list of known protein identifiers chosen by the biologist enters into the software to perform different multiple sequence alignments and finally phylogenetic analysis.

Created: 2010-06-29 | Last updated: 2010-08-31

Credits: Achille Zappa

Attributions: EBI_ClustalW_alignment_tree

Taverna 2

Uploader

Anja Le Blanc

Extracting data from VOTable format by usi... (1)

Download

Input VOTable and 'name' of a Output corrosponding data of that field in an arrayInput VOTable and 'name' of a Field

Created: 2010-07-01 | Last updated: 2010-07-01

Credits: Anja Le Blanc Donal Fellows

Taverna 2

Uploader

Alan Williams

A workflow version of the EMBOSS tutorial (1)

Download

Designed to show the use of EMBOSS based Soaplab services from Taverna, this workflow has no inputs as all initial values are specified as string constants. A sequence set is fetched using the seqret tool, then simultaneously scanned for predicted transmembrane regions and subjected to a multiple alignment using emma. This alignment is then plotted to a set of PNG images and also used to build a profile using the prophecy and prophet tools.

Created: 2010-07-04 | Last updated: 2010-07-04

Credits: Tomoinn

Taverna 2

Uploader

Alan Williams

BiomartAndEMBOSSAnalysis (1)

Download

Using Biomart and EMBOSS soaplab services, This workflow retrieves a number of sequences from 3 species: mouse, human, rat; align them, and returns a plot of the alignment result. Corresponding sequence ids are also returned.

Created: 2010-07-04 | Last updated: 2010-07-04

Credits: Alan Williams

Taverna 2

Uploader

Alan Williams

BioMoby tutorial workflow (1)

Download

A workflow from part of the BioMoby tutorial

Created: 2010-07-04 | Last updated: 2010-07-04

Credits: EdwardKawas

Taverna 2

Uploader

Alan Williams

Demonstration of configurable iteration (1)

Download

This workflow shows the use of the iteration strategy editor to ensure that only relevant combinations of inputs are used during an implicit iteration.

Created: 2010-07-04 | Last updated: 2010-07-04

Credits: Tomoinn

Taverna 2

Uploader

Alex Nenadic

Get survey data from SurveyMapper (2)

Download

Extracting public data (such as public surveys and their questions) from SurveyMapper. SurveyMapper (http://www.surveymapper.com/) a free real-time geographic survey and polling tool from the nice people at the Centre for Advanced Spatial Analysis, University College London.

Created: 2010-04-21 | Last updated: 2010-06-18

Credits: Alex Nenadic

Taverna 2

Uploader

Francois Belleau

ChEBI mashup from searched string (1)

Download

A demo showing hoe to use SOAP services from Bio2RDF ChEBI SPARQL endpoint.A demo showing hoe to use SOAP services from Bio2RDF ChEBI SPARQL endpoint. First a full text search query is done, then we do a reverse link query to get all the related topic. Finally with a describe queries we obtain the complete graph of each topic. The ntriples result is a mashup of what is known about this searched topic form ChEBI. This graph can then be loaded in a triplestore for further exploration.

Created: 2010-04-29

Credits: Francois Belleau

Taverna 2

Uploader

Nadia Cerezo

Get KEGG gene descriptions and pathways (1)

Download

This workflow takes a list of KEGG gene identifiers and supplies descriptions associated to said genes + pathways including all genes and the descriptions associated to said pathways. The list_to_string local beanshell scripts merely transform a given list into a string of unique not-null elements separated by new lines (for batch btit use). Note that the input is a real taverna list : multiple values must be declared as multiple values instead of a single string value with distinct identif...