Workflows

Virus genome extraction workflow (1)

• Download

Retrieve genome entries which agree with the following conditions regarding the Definition item of entries from both VRL and PHG division in DDBJ. Includes "complete sequence" or includes "segment" and "complete sequence" Not include "TPA:" and "nearly complete"

Created: 2010-05-13 | Last updated: 2010-05-13

Credits: wabi

BLAST-ClustalW workflow (1)

• Download

Execute blastn against DDBJ database with a given DNA sequence and compare the alignment regions of high similar sequences by using ClustalW.

Created: 2010-05-13 | Last updated: 2010-05-13

Credits: wabi

BLAST workflow (1)

• Download

You can get three BLAST results against DDBJ, swiss-prot and PDB by using accession number of DDBJ.

Created: 2010-05-13 | Last updated: 2010-05-13

Credits: wabi

EntrezGeneId_to_GOFunction (1)

• Download

The workflow takes a list of Entrez gene ids and returns the corresponding GO function definitions. Example value: 1306 486 4712 108 9912 7639 23786

Created: 2010-05-13 | Last updated: 2010-05-13

Credits: Franck Tanoh

Warp2D - 2D Time Alignment Workflow (3)

• Download

2D Time Alignment We describe a new time alignment method that takes advantage of both dimensions of LC-MS data to resolve ambiguities in peak matching while remaining computationally efficient. This approach, Warp2D, combines peak extraction with a two-dimensional correlation function to provide a reliable alignment scoring function that is insensitive to spurious peaks and background noise. One-dimensional alignment methods are often based on the total-ion-current eluti...

Created: 2010-05-20 | Last updated: 2010-11-22

Credits: Ishtiaq AHMAD

simple HEC query (2)

• Download

HEC query for table 'goes_xray_flare'

Created: 2010-05-21 | Last updated: 2010-08-04

Credits: Anja Le Blanc

Retrieve Instruments for event dates (2)

• Download

Queries the HELIO ICS web service and returns a list of instruments available for the time periodes in VOTable format

Created: 2010-05-26

Credits: Anja Le Blanc

Invoke a secured caGrid service: caTissue (2)

• Download

No description

Created: 2010-05-24 | Last updated: 2010-11-05

Credits: Wei Tan

A simple CQL query workflow in caGrid (1)

• Download

1. CQL is a language to query data from caGrid/caBIG services. This workflow is tested with Taverna 2.1.2 and the caGrid Workflow Suite downloadable from http://www.mcs.anl.gov/~wtan/t2/. 2.More information regarding CQL can be found from http://wiki.cagrid.org/display/dataservices. 3. Sample input (95) is provided in the workflow. It is to query all the hybridization data within a microarray experiment whose id is 95.

Created: 2010-05-24 | Last updated: 2010-05-25

Credits: Wei Tan

Simple DPAS query (4)

• Download

queries dpas for each time priode and instrument

Created: 2010-05-26 | Last updated: 2011-12-15

Credits: Anja Le Blanc

Provenance Challenge 1 workflow -- mockup ... (1)

• Download

simulates the image processing for the PC1 workflow using beanshell that simply track test strings an image is a pair (header, image) specified as a list of depth 1: [header,image] so each processor with image input takes an input list. Note that the processors are designed to operate on single images (except softmean that operates on a list of images), but because the initial input is a list of images, all are processed by implicit iteration.

Created: 2010-05-28

Credits: Paolo

Using HEK information to get DPAS data (1)

• Download

Query HEK for all kinds of events and query DPAS for given instrument for data from event times.

Created: 2010-06-10 | Last updated: 2010-06-10

Credits: Anja Le Blanc

Nucleotide FASTA to PDB file. (1)

• Download

This workflow is designed to convert nucleotide fasta sequence to corresponding pdb file,which could be used for modelling. In this workflow nucleotide fasta sequence is given as input, eg. >gi|119889797|ref|XM_864887.2| PREDICTED: Bos taurus amylase, alpha 2A (pancreatic), transcript variant 2 (AMY2A), mRNA ATGAAGTTTTTTCTGTTGCTTTCAGCAATTGGGTTCTGCTGGGCTCAGTATGACCCACACGTCAAATCTG GACGGACCTCCATTGTCCATCTGTTTGAGTGGCGCTGGGTAGATATTGCTCTTGAATGTGAGCGATACTT AGCCCCCAAAGGATTTGGAGGGGTTCAGGTCTCCCCAC...

Created: 2010-06-11 | Last updated: 2010-06-11

Credits: Prateek

Provenance Challenge 1 workflow part A -- ... (1)

• Download

No description

Created: 2010-06-21 | Last updated: 2010-06-21

Credits: Paolo

Provenance Challenge 1 workflow part B -- ... (1)

• Download

No description

Created: 2010-06-21 | Last updated: 2010-06-21

Credits: Paolo

Syntetic population mapper (3)

• Download

This workflow creates individual-level population from census data and then joins with the BHPS (British Household Panel Survey) and reaggregates. In the last stage it maps the chosen BHPS field.

Created: 2010-06-23 | Last updated: 2010-12-09

Credits: Alex Nenadic

Workflow for Automated Comparative Protein... (2)

• Download

This workflow performs "parallel" generic protein sequence analysis. In order to do that a list of known protein identifiers chosen by the biologist enters into the software to perform different multiple sequence alignments and finally phylogenetic analysis.

Created: 2010-06-29 | Last updated: 2010-08-31

Credits: Achille Zappa

Attributions: EBI_ClustalW_alignment_tree

Extracting data from VOTable format by usi... (1)

• Download

Input VOTable and 'name' of a Output corrosponding data of that field in an arrayInput VOTable and 'name' of a Field

Created: 2010-07-01 | Last updated: 2010-07-01

Credits: Anja Le Blanc Donal Fellows

A workflow version of the EMBOSS tutorial (1)

• Download

Designed to show the use of EMBOSS based Soaplab services from Taverna, this workflow has no inputs as all initial values are specified as string constants. A sequence set is fetched using the seqret tool, then simultaneously scanned for predicted transmembrane regions and subjected to a multiple alignment using emma. This alignment is then plotted to a set of PNG images and also used to build a profile using the prophecy and prophet tools.

Created: 2010-07-04 | Last updated: 2010-07-04

Credits: Tomoinn

BiomartAndEMBOSSAnalysis (1)

• Download

Using Biomart and EMBOSS soaplab services, This workflow retrieves a number of sequences from 3 species: mouse, human, rat; align them, and returns a plot of the alignment result. Corresponding sequence ids are also returned.

Created: 2010-07-04 | Last updated: 2010-07-04

Credits: Alan Williams

BioMoby tutorial workflow (1)

• Download

A workflow from part of the BioMoby tutorial

Created: 2010-07-04 | Last updated: 2010-07-04

Credits: EdwardKawas

Demonstration of configurable iteration (1)

• Download

This workflow shows the use of the iteration strategy editor to ensure that only relevant combinations of inputs are used during an implicit iteration.

Created: 2010-07-04 | Last updated: 2010-07-04

Credits: Tomoinn

Get survey data from SurveyMapper (2)

• Download

Extracting public data (such as public surveys and their questions) from SurveyMapper. SurveyMapper (http://www.surveymapper.com/) a free real-time geographic survey and polling tool from the nice people at the Centre for Advanced Spatial Analysis, University College London.

Created: 2010-04-21 | Last updated: 2010-06-18

Credits: Alex Nenadic

ChEBI mashup from searched string (1)

• Download

A demo showing hoe to use SOAP services from Bio2RDF ChEBI SPARQL endpoint.A demo showing hoe to use SOAP services from Bio2RDF ChEBI SPARQL endpoint. First a full text search query is done, then we do a reverse link query to get all the related topic. Finally with a describe queries we obtain the complete graph of each topic. The ntriples result is a mashup of what is known about this searched topic form ChEBI. This graph can then be loaded in a triplestore for further exploration.

Created: 2010-04-29

Credits: Francois Belleau

Get KEGG gene descriptions and pathways (1)

• Download

This workflow takes a list of KEGG gene identifiers and supplies descriptions associated to said genes + pathways including all genes and the descriptions associated to said pathways. The list_to_string local beanshell scripts merely transform a given list into a string of unique not-null elements separated by new lines (for batch btit use). Note that the input is a real taverna list : multiple values must be declared as multiple values instead of a single string value with distinct identif...

Created: 2010-04-30 | Last updated: 2010-04-30

Credits: Nadia Cerezo Paul Fisher

Attributions: Get Kegg Gene information