Workflows

Virus genome extraction workflow (1)

• Download

Retrieve genome entries which agree with the following conditions regarding the Definition item of entries from both VRL and PHG division in DDBJ. Includes "complete sequence" or includes "segment" and "complete sequence" Not include "TPA:" and "nearly complete"

Created: 2010-05-13 | Last updated: 2010-05-13

Credits: wabi

BLAST-ClustalW workflow (1)

• Download

Execute blastn against DDBJ database with a given DNA sequence and compare the alignment regions of high similar sequences by using ClustalW.

Created: 2010-05-13 | Last updated: 2010-05-13

Credits: wabi

BLAST workflow (1)

• Download

You can get three BLAST results against DDBJ, swiss-prot and PDB by using accession number of DDBJ.

Created: 2010-05-13 | Last updated: 2010-05-13

Credits: wabi

EntrezGeneId_to_GOFunction (1)

• Download

The workflow takes a list of Entrez gene ids and returns the corresponding GO function definitions. Example value: 1306 486 4712 108 9912 7639 23786

Created: 2010-05-13 | Last updated: 2010-05-13

Credits: Franck Tanoh

Warp2D - 2D Time Alignment Workflow (3)

• Download

2D Time Alignment We describe a new time alignment method that takes advantage of both dimensions of LC-MS data to resolve ambiguities in peak matching while remaining computationally efficient. This approach, Warp2D, combines peak extraction with a two-dimensional correlation function to provide a reliable alignment scoring function that is insensitive to spurious peaks and background noise. One-dimensional alignment methods are often based on the total-ion-current eluti...

Created: 2010-05-20 | Last updated: 2010-11-22

Credits: Ishtiaq AHMAD

simple HEC query (2)

• Download

HEC query for table 'goes_xray_flare'

Created: 2010-05-21 | Last updated: 2010-08-04

Credits: Anja Le Blanc

Retrieve Instruments for event dates (2)

• Download

Queries the HELIO ICS web service and returns a list of instruments available for the time periodes in VOTable format

Created: 2010-05-26

Credits: Anja Le Blanc

Invoke a secured caGrid service: caTissue (2)

• Download

No description

Created: 2010-05-24 | Last updated: 2010-11-05

Credits: Wei Tan

A simple CQL query workflow in caGrid (1)

• Download

1. CQL is a language to query data from caGrid/caBIG services. This workflow is tested with Taverna 2.1.2 and the caGrid Workflow Suite downloadable from http://www.mcs.anl.gov/~wtan/t2/. 2.More information regarding CQL can be found from http://wiki.cagrid.org/display/dataservices. 3. Sample input (95) is provided in the workflow. It is to query all the hybridization data within a microarray experiment whose id is 95.

Created: 2010-05-24 | Last updated: 2010-05-25

Credits: Wei Tan

Simple DPAS query (4)

• Download

queries dpas for each time priode and instrument

Created: 2010-05-26 | Last updated: 2011-12-15

Credits: Anja Le Blanc

Provenance Challenge 1 workflow -- mockup ... (1)

• Download

simulates the image processing for the PC1 workflow using beanshell that simply track test strings an image is a pair (header, image) specified as a list of depth 1: [header,image] so each processor with image input takes an input list. Note that the processors are designed to operate on single images (except softmean that operates on a list of images), but because the initial input is a list of images, all are processed by implicit iteration.

Created: 2010-05-28

Credits: Paolo

Using HEK information to get DPAS data (1)

• Download

Query HEK for all kinds of events and query DPAS for given instrument for data from event times.

Created: 2010-06-10 | Last updated: 2010-06-10

Credits: Anja Le Blanc

Nucleotide FASTA to PDB file. (1)

• Download

This workflow is designed to convert nucleotide fasta sequence to corresponding pdb file,which could be used for modelling. In this workflow nucleotide fasta sequence is given as input, eg. >gi|119889797|ref|XM_864887.2| PREDICTED: Bos taurus amylase, alpha 2A (pancreatic), transcript variant 2 (AMY2A), mRNA ATGAAGTTTTTTCTGTTGCTTTCAGCAATTGGGTTCTGCTGGGCTCAGTATGACCCACACGTCAAATCTG GACGGACCTCCATTGTCCATCTGTTTGAGTGGCGCTGGGTAGATATTGCTCTTGAATGTGAGCGATACTT AGCCCCCAAAGGATTTGGAGGGGTTCAGGTCTCCCCAC...

Created: 2010-06-11 | Last updated: 2010-06-11

Credits: Prateek

Provenance Challenge 1 workflow part A -- ... (1)

• Download

No description

Created: 2010-06-21 | Last updated: 2010-06-21

Credits: Paolo

Provenance Challenge 1 workflow part B -- ... (1)

• Download

No description

Created: 2010-06-21 | Last updated: 2010-06-21

Credits: Paolo

Syntetic population mapper (3)

• Download

This workflow creates individual-level population from census data and then joins with the BHPS (British Household Panel Survey) and reaggregates. In the last stage it maps the chosen BHPS field.

Created: 2010-06-23 | Last updated: 2010-12-09

Credits: Alex Nenadic

Workflow for Automated Comparative Protein... (2)

• Download

This workflow performs "parallel" generic protein sequence analysis. In order to do that a list of known protein identifiers chosen by the biologist enters into the software to perform different multiple sequence alignments and finally phylogenetic analysis.

Created: 2010-06-29 | Last updated: 2010-08-31

Credits: Achille Zappa

Attributions: EBI_ClustalW_alignment_tree

Extracting data from VOTable format by usi... (1)

• Download

Input VOTable and 'name' of a Output corrosponding data of that field in an arrayInput VOTable and 'name' of a Field

Created: 2010-07-01 | Last updated: 2010-07-01

Credits: Anja Le Blanc Donal Fellows

A workflow version of the EMBOSS tutorial (1)

• Download

Designed to show the use of EMBOSS based Soaplab services from Taverna, this workflow has no inputs as all initial values are specified as string constants. A sequence set is fetched using the seqret tool, then simultaneously scanned for predicted transmembrane regions and subjected to a multiple alignment using emma. This alignment is then plotted to a set of PNG images and also used to build a profile using the prophecy and prophet tools.

Created: 2010-07-04 | Last updated: 2010-07-04

Credits: Tomoinn

BiomartAndEMBOSSAnalysis (1)

• Download

Using Biomart and EMBOSS soaplab services, This workflow retrieves a number of sequences from 3 species: mouse, human, rat; align them, and returns a plot of the alignment result. Corresponding sequence ids are also returned.

Created: 2010-07-04 | Last updated: 2010-07-04

Credits: Alan Williams

BioMoby tutorial workflow (1)

• Download

A workflow from part of the BioMoby tutorial

Created: 2010-07-04 | Last updated: 2010-07-04

Credits: EdwardKawas

Demonstration of configurable iteration (1)

• Download

This workflow shows the use of the iteration strategy editor to ensure that only relevant combinations of inputs are used during an implicit iteration.

Created: 2010-07-04 | Last updated: 2010-07-04

Credits: Tomoinn

Get survey data from SurveyMapper (2)

• Download

Extracting public data (such as public surveys and their questions) from SurveyMapper. SurveyMapper (http://www.surveymapper.com/) a free real-time geographic survey and polling tool from the nice people at the Centre for Advanced Spatial Analysis, University College London.

Created: 2010-04-21 | Last updated: 2010-06-18

Credits: Alex Nenadic

ChEBI mashup from searched string (1)

• Download

A demo showing hoe to use SOAP services from Bio2RDF ChEBI SPARQL endpoint.A demo showing hoe to use SOAP services from Bio2RDF ChEBI SPARQL endpoint. First a full text search query is done, then we do a reverse link query to get all the related topic. Finally with a describe queries we obtain the complete graph of each topic. The ntriples result is a mashup of what is known about this searched topic form ChEBI. This graph can then be loaded in a triplestore for further exploration.

Created: 2010-04-29

Credits: Francois Belleau

Get KEGG gene descriptions and pathways (1)

• Download

This workflow takes a list of KEGG gene identifiers and supplies descriptions associated to said genes + pathways including all genes and the descriptions associated to said pathways. The list_to_string local beanshell scripts merely transform a given list into a string of unique not-null elements separated by new lines (for batch btit use). Note that the input is a real taverna list : multiple values must be declared as multiple values instead of a single string value with distinct identif...

Created: 2010-04-30 | Last updated: 2010-04-30

Credits: Nadia Cerezo Paul Fisher

Attributions: Get Kegg Gene information

Genes encoded by KEGG pathway (1)

• Download

Takes a KEGG pathway (e.g. hsa00232), finds the proteins that those genes code for and returns the sequences of those proteins.

Created: 2010-04-30 | Last updated: 2010-05-01

Uniprot Protein Visualization (1)

• Download

Jmol 3D visualization of a protein structure.

Created: 2010-05-01 | Last updated: 2010-05-01

Updated Biomart and Emboss workflow (2)

• Download

No description

Created: 2009-05-12

Credits: George

simpleBLAST workflow (2)

• Download

my first taverna workflow

Created: 2009-05-13

Credits: Shahid

Taverna rendering of the PAN-STARRS workfl... (1)

• Download

Example inputs: CSVRootPath = /Users/paolo/Documents/myGRID/OPM/PC3/SampleData/J062941 JobID:J062941  

Created: 2009-04-30

Credits: Paolo

Load GO terms in the triplestore (1)

• Download

No description

Created: 2009-05-01

Credits: Francois Belleau

Using CQL to query protein sequence data (1)

• Download

To query protein sequence infomation out of 3 caGrid data services: caBIO, CPAS and GridPIR Adapted from http://www.myexperiment.org/workflows/600

Created: 2009-05-07

Credits: Stian Soiland-Reyes

Attributions: Using CQL to query protein sequence data

ICDAR 2011 End-to-End Applications contest... (1)

• Download

Full workflow for use with the DAE platform and as used for the ICDAR 2011 "Document Analysis Algorithm Contributions in End-to-End Applications" contest, including contributed algorithms.

Created: 2012-04-14 | Last updated: 2012-04-14

Credits: Bart Lamiroy

Match gene lists based on information in l... (7)

• Download

[THIS WORKFLOW IS IN BETA STAGE] This workflow computes the match between two lists of Entrez Gene Identifiers by means of concept profile matching (Jelier et al., van Haagen et al.). The result of this is a list of concepts ordered by their matching score (the length of the list set by maxMatchNr). Of this list the summed scores are explained by computing the concepts that contribute most to the combination of the matching genes. Example to explain (by analogy): When a group of informatic...

Created: 2012-04-17 | Last updated: 2012-04-25

Credits: Marco Roos Reinout van Schouwen Eleni Kristina Hettne BioSemantics

Attributions: Match concept profiles Explain concept scores

SNP Position Information (1)

• Download

This workflow extracts information about the position of SNPs and the genes they are associated with, using BioMart (ENSEMBL Variation 66).

Created: 2012-04-17 | Last updated: 2012-04-17

Credits: Katy Wolstencroft

GetCities2 (1)

• Download

 Get cities by entering a country name

Created: 2012-05-03 | Last updated: 2012-05-03

Credits: Xiaoxiaoshijie

Get FlyTED Gene Expression Images for a Ge... (1)

• Download

This is a simple workflow testing running a restful service in Taverna. This restful service http://www.open-biomed.org.uk/service/flyted/records/probe/{probe} is part of the flykit/flyted services http://code.google.com/p/open-biomed/wiki/Flyted, which is built using the Talis Puelia Linked Data API (http://code.google.com/p/puelia-php/). We want to use this simple workflow to test the idea of bridging linked data and scientific workflows using Restful services. A test input gene name can ...

Created: 2012-05-04 | Last updated: 2012-05-04

Credits: Junzhao

Get Alternative Gene Names for a Drosophil... (1)

• Download

This is a simple workflow testing running a restful service in Taverna. This restful service http://www.open-biomed.org.uk/service/flybase/features/name/{name} is part of the flykit/flybase services http://code.google.com/p/open-biomed/wiki/Flybase, which is built using the Talis Puelia Linked Data API (http://code.google.com/p/puelia-php/). We want to use this simple workflow to test the idea of bridging linked data and scientific workflows using Restful services. A test input gene name...

Created: 2012-05-04 | Last updated: 2012-05-04

Credits: Junzhao

Search for Gene Expression Images using an... (1)

• Download

This is a simple workflow demonstrating how to integrate multiple linked data sources using restful services in Taverna. In this workflow it first searches for all possible gene names for a query gene from FlyBase repository, an authorative genetic database for Drosophila research, and then it uses returned gene names to search for gene expression images from Oxford FlyTED image repository. Two Restful services were used: One for retrieving all flybase features matching a querying ge...

Created: 2012-05-04 | Last updated: 2012-05-08

Credits: Junzhao

Run on amazon cloud (1)

• Download

 Execute commands on amazon cloud machines Manual and documentation at: http://www.students.ncl.ac.uk/g.georgiou/newweb/

Created: 2012-05-04 | Last updated: 2012-05-04

Credits: Georgeg9 BioGreen Ltd.

FINAL VERSION (1)

• Download

 From genome to genbank file and annotations Manual and documentation at: http://www.students.ncl.ac.uk/g.georgiou/newweb/

Created: 2012-05-04 | Last updated: 2012-05-04

Credits: Georgeg9 BioGreen Ltd.

Attributions: Convert to KEGG ID NCBI Gi to Kegg Pathways EBI_NCBI_BLAST EBI_InterproScan_NewServices

Get top blastx hit of a list of contigs (1)

• Download

This workflow takes a contigs.fasta file , gets all the ORF's present in it , runs blastx on each ORF, gets the FASTA file of the top blastX hit and its GI number.

Created: 2012-05-04 | Last updated: 2012-05-04

Credits: BioCo Consultants

generateWholeSeqAnnotation (1)

• Download

 This work flow is used for genereating all the known genes together to annotate a whole or a large region of genome sequence.   outputfilrURL:  the location of the output file Ginumber:   the input gi gene number wholeGenomeSeq:    the whold sequence annotation information output:    the output of genbank text

Created: 2012-05-04 | Last updated: 2012-05-04

Credits: BioCo Consultants

ConcatStringTogether (1)

• Download

 This workflow is as simple as you can imagine! It can be used to remove the information tags in a fasta file and concat the sequence together   fastaURL :  the input fasta reads file location seqURL : the outcome sequence file location wholeSeq : the output sequence as an entire string

Created: 2012-05-04 | Last updated: 2012-05-04

Credits: BioCo Consultants

filterDifferenceInLists (1)

• Download

 This workflow output a list of the protein or any string hits in the first list but not in the second list.    output : output file location com : comparision protein list our : interested protein list out1: output as a string

Created: 2012-05-04 | Last updated: 2012-05-04

Credits: BioCo Consultants

extractGInumber (1)

• Download

 This workflow uses regex pattern to compare the identity percentage of each hits against the input sequnece and return the whole information of the hits and the GI number of them (if they including the GI number as a sub information)   inputfileURL:  the location of the Gi number   outputText  : the list of all the hits and the GI number of them

Created: 2012-05-04 | Last updated: 2012-05-04

Credits: BioCo Consultants

Check Java Cryptography Unlimited Strength (1)

• Download

Checks if Java Cryptography Extension (JCE) Unlimited Strength Jurisdiction Policy Files is installed, and redirects user to correct download page and relevant lib/security folder if not.

Created: 2012-05-08 | Last updated: 2012-05-08

Credits: Stian Soiland-Reyes

Attributions: Find/show Taverna's home directory

Find workflow ancestors (2)

• Download

Given a t2flow file (Taverna 2 workflow), extract ancestor workflow UUIDs and search myExperiment for matching workflow entries. Note that this will also match the workflow itself and nested workflows, but does not match against other workflows having the same ancestors (but newer UUIDs).

Created: 2012-05-08 | Last updated: 2012-07-09

Credits: Stian Soiland-Reyes

Simple image migration (1)

• Download

Then starts a migration action on an image and extracts properties from the original and migrated image. The properties are compared and a QA algorithms is started on the image data itself .

Created: 2012-05-08 | Last updated: 2012-05-08

Credits: Markus Plangg