All content

Search filter terms
Filter by category
Filter by type
Filter by tag
Filter by user
Filter by licence
Filter by group
Filter by wsdl
Filter by curation
Results per page:
Sort by:
Showing 4527 results. Use the filters on the left and the search box below to refine the results.
Uploader

Blob Kegg pathway identifiers

Created: 2009-04-08 19:28:52 | Last updated: 2009-08-10 11:03:00

Credits: User Paul Fisher

License: Creative Commons Attribution-Share Alike 3.0 Unported License

This file contains a list of KEGG pathway identifiers, derived from a list of Ensembl genes found to be located with a given QTL/chromosomal region in the mouse. These genes are located in the Tir1 QTL.

File type: Plain text

Comments: 0 | Viewed: 76 times | Downloaded: 62 times

Tags:

Uploader

Blob Kegg pathway descriptions

Created: 2009-04-08 19:27:55 | Last updated: 2009-08-10 11:29:34

Credits: User Paul Fisher

License: Creative Commons Attribution-Share Alike 3.0 Unported License

This file contains a list of KEGG pathway descriptions, identified from genes found within the Tir1 QTL region (for African Trypanosomiasis). Each pathway may contain multiple genes from within the QTL region.

File type: Plain text

Comments: 0 | Viewed: 69 times | Downloaded: 53 times

Tags:

Uploader

Blob Kegg pathways and genes

Created: 2009-04-08 19:26:26 | Last updated: 2009-08-10 11:41:55

Credits: User Paul Fisher

License: Creative Commons Attribution-Share Alike 3.0 Unported License

This file contains a list of all genes found within the Tir1 QTL region. These are represented as KEGG gene identifiers. Each gene is listed in tab deliminated format along with all KEGG pathway ids in which the gene is involved. These are given as KEGG pathway identifiers. Each gene may be included in zero or more pathways, with multiple instances of the same pathway being included in the file (due to multiple genes included in a single pathway).

File type: Plain text

Comments: 0 | Viewed: 73 times | Downloaded: 55 times

Tags:

Uploader

Blob Kegg Pathway release

Created: 2009-04-08 19:25:05 | Last updated: 2009-08-10 12:06:18

Credits: User Paul Fisher

License: Creative Commons Attribution-Share Alike 3.0 Unported License

This file contains the version of the KEGG pathway database used in the analysis of the Tir1 QTL region

File type: Plain text

Comments: 0 | Viewed: 66 times | Downloaded: 48 times

Tags:

Uploader

Blob Kegg-Uniprot-Entrez cross-references

Created: 2009-04-08 19:23:53 | Last updated: 2009-08-10 12:08:00

Credits: User Paul Fisher

License: Creative Commons Attribution-Share Alike 3.0 Unported License

This file contains a list of KEGG gene identifiers, cross-referenced to UniProt and Entrez identifiers. The UniProt and Entrez ids were obtained from BioMart for genes located in the Tir1 QTL region.

File type: Plain text

Comments: 0 | Viewed: 92 times | Downloaded: 92 times

Tags:

Uploader

Blob Kegg gene descriptions

Created: 2009-04-08 18:06:23 | Last updated: 2009-08-10 12:10:07

Credits: User Paul Fisher

License: Creative Commons Attribution-Share Alike 3.0 Unported License

This file contains a list of KEGG gene descriptions, for each KEGG gene identified within the Tir1 QTL region.

File type: Plain text

Comments: 0 | Viewed: 88 times | Downloaded: 66 times

Tags:

Uploader

Blob Ensembl database release

Created: 2009-04-08 18:00:35 | Last updated: 2009-08-10 12:12:09

Credits: User Paul Fisher

License: Creative Commons Attribution-Share Alike 3.0 Unported License

The release of the Ensembl database used to identify genes in Tir1 QTL region.

File type: Plain text

Comments: 0 | Viewed: 68 times | Downloaded: 43 times

Tags:

Uploader

Blob Tir1 QTL - microarray day 7 intersecting pathways

Created: 2009-04-08 17:57:57

Credits: User Paul Fisher

License: Creative Commons Attribution-Share Alike 3.0 Unported License

This spreadhseet contains all of the intersecting pathways between the Tir1 QTL and day 7 differentially expressed genes

File type: Excel workbook

Comments: 0 | Viewed: 102 times | Downloaded: 75 times

Tags:

Uploader

Blob Tir1 QTL - Day 3 Microarray intersecting pathways

Created: 2009-04-08 17:56:10

Credits: User Paul Fisher

License: Creative Commons Attribution-Share Alike 3.0 Unported License

This spreadhseet contains all of the intersecting pathways between the Tir1 QTL and day 3 differentially expressed genes

File type: Excel workbook

Comments: 0 | Viewed: 92 times | Downloaded: 64 times

Tags:

Uploader

Blob Re-sequenced Daxx gene info

Created: 2009-04-08 17:53:46 | Last updated: 2009-08-10 12:30:59

Credits: User Paul Fisher

License: Creative Commons Attribution-Share Alike 3.0 Unported License

This spreadsheet contains information about the re-sequencing of the daxx gene, identified as a candidate QTg for the African Trypanosomiasis resiatance phenotype. This file is related to the paper: http://www.ncbi.nlm.nih.gov/pubmed/17709344

File type: Excel workbook

Comments: 0 | Viewed: 89 times | Downloaded: 49 times

Tags:

Uploader

Blob Authors table

Created: 2009-04-08 13:36:10 | Last updated: 2009-08-10 12:37:37

Credits: User Paul Fisher

License: Creative Commons Attribution-Share Alike 3.0 Unported License

This table contains a list of articles used to construct a list of issues with regards to the lack of systematic and explicit data analyses conducted in bioinformatcis. Each author list is linked directly to their publication within PubMed.

File type: Excel workbook

Comments: 0 | Viewed: 60 times | Downloaded: 34 times

Tags:

Uploader

Blob Table of SNP sequenceing results

Created: 2009-04-08 13:29:32

Credits: User Paul Fisher

License: Creative Commons Attribution-Share Alike 3.0 Unported License

This file contains the results of re-sequencing the Daxx gene

File type: Word document

Comments: 0 | Viewed: 941 times | Downloaded: 70 times

Tags:

Uploader

Blob Candidate Gene protocol

Created: 2009-04-08 13:27:20

Credits: User Paul Fisher

License: Creative Commons Attribution-Share Alike 3.0 Unported License

This protocol provides details on how to identify candidate genes from the returned workflow results.

File type: Word document

Comments: 0 | Viewed: 132 times | Downloaded: 91 times

Tags:

Uploader

Blob A Systematic Strategy for Large-Scale Analysis of Ge...

Created: 2009-04-08 13:23:03

Credits: User Paul Fisher

License: Creative Commons Attribution-Share Alike 3.0 Unported License

This PDF is my personal copy of the NAR publication.

File type: Adobe PDF

Comments: 0 | Viewed: 96 times | Downloaded: 73 times

Tags:

Uploader

Workflow Fetch PDB flatfile from RCSB server (1)

Thumb
Given an identifier such as '1crn' fetches the PDB format flatfile from the RCSB

Created: 2009-03-08

Credits: User Pvilaca

Workflow omim and pathways (2)

Thumb
This workflow searches OMIM for entries associated with a particular disease in OMIM, returns the IDs and maps them to Kegg Gene IDs. For each gene, it then gets the description and any corresponding pathways those genes are involved with

Created: 2009-03-03 | Last updated: 2009-11-02

Credits: User Katy Wolstencroft User Paul Fisher

Attributions: Workflow Get Kegg Gene information

Uploader

Blob Murin.owl ontology designed with Ontowiz

Created: 2009-02-17 04:45:12 | Last updated: 2009-02-17 05:00:49

Credits: User Francois Belleau

License: Creative Commons Attribution-Share Alike 3.0 Unported License

The ontology of the Murin protocol was designed with Protege Ontowiz tool.

File type: GIF image

Comments: 0 | Viewed: 72 times | Downloaded: 49 times

Tags:

Uploader

Blob Pubmed rdfiser from Bio2RDF project

Created: 2009-02-11 06:00:37 | Last updated: 2009-02-11 06:32:03

Credits: User Francois Belleau

License: Creative Commons Attribution-Share Alike 3.0 Unported License

This file is needed to use Pubmed2n3 rdfizer workflow.

File type: XML

Comments: 0 | Viewed: 82 times | Downloaded: 34 times

Tags:

Creator

Pack A test pack of stuff


Created: 2009-02-09 16:33:33 | Last updated: 2009-02-09 16:34:03

Testing what I can do with packs.

1 item in this pack

Comments: 0 | Viewed: 49 times | Downloaded: 29 times

Tags:

Creator

Pack Delete unwanted DNA from plasmids


Created: 2009-02-04 06:34:43 | Last updated: 2009-02-04 15:47:23

  psg5 (for HEG0 ERa, EcoR1): https://www.lablife.org/pglabs?f=c&cmd=viewvecseq&vectorid=3768 1021 GTAATACGACTCACTATAGGGCG AATT CGGATCCAGATCTTATTAAAGCA GAACTTGTTT Forward: 5'-ATACGACTCACTATAGGGCGCGGATCCAGATCTTAT-3' (20, 16) Reverse: 5'-TAATAAGATCTGGATCCGCGCCCTATAGTGAGTCG-3' (18, 17)   pGL2 (for p15 4xSBR1, kpn1, insert: 160 bp): https://www.lablife.org/pglabs?f=c&cmd=viewvecseq&vectorid=3345 1 cccgggaggtaccgagctcttacgcgtgct agctcgagat ctaagtaagc 5551 ccaaactc...

0 items in this pack

Comments: 0 | Viewed: 44 times | Downloaded: 8 times

This Pack has no tags!

Uploader

Blob London Roadshow PDF

Created: 2009-01-29 13:58:35

Credits: User Dfmac

License: Creative Commons Attribution-Share Alike 3.0 Unported License

 David Fergusson's presentation as PDF

File type: Adobe PDF

Comments: 0 | Viewed: 63 times | Downloaded: 56 times

Tags:

Uploader

Blob input file for feat group analysis workflow

Created: 2009-01-28 17:31:10

Credits: User Glatard

License: Creative Commons Attribution-Share Alike 3.0 Unported License

To be used with VBrowser as input of workflow http://www.myexperiment.org/workflows/640

File type: Binary data

Comments: 0 | Viewed: 51 times | Downloaded: 23 times

This File has no tags!

Uploader

Blob input file for feat individual analysis workflow

Created: 2009-01-28 17:23:01

Credits: User Glatard

License: Creative Commons Attribution-Share Alike 3.0 Unported License

To be used with the VBrowser as inputs of workflow http://www.myexperiment.org/workflows/639

File type: Binary data

Comments: 0 | Viewed: 40 times | Downloaded: 22 times

This File has no tags!

Uploader

Blob JISC eRoadshow at Kings, London

Created: 2009-01-14 10:23:32 | Last updated: 2009-01-14 10:24:05

Credits: User Dfmac

License: Creative Commons Attribution-Share Alike 3.0 Unported License

 JISC eRoadshow at Kings, London

File type: Adobe PDF

Comments: 0 | Viewed: 52 times | Downloaded: 37 times

Tags:

Uploader

Blob Results of the Mapping oligonucleotides to an assembly

Created: 2008-12-19 09:53:23

Credits: User Wassinki

License: Creative Commons Attribution-Share Alike 3.0 Unported License

This zip file contains the results of the complete input set analysed by the "Mapping oligonucleotides to an assembly" workflow.

File type: ZIP archive

Comments: 0 | Viewed: 73 times | Downloaded: 35 times

This File has no tags!

Results per page:
Sort by: